Labour Calls For National Lockdown
When Labour leader Keir Starmer last week questioned whether local lockdowns were working because 19 out of 20 had failed to reduce cases we should have guessed it was the local bit he was taking issue with, not the lockdown. Tory lockdown rebels heroes had been wondering out loud why Labour kept criticising the Government’s measures but then supporting them or abstaining, and now they know. It’s because they think they don’t go far enough.
Unhappy northern Labour council leaders likewise are not complaining about their areas being locked down per se. They’re complaining about being singled out and treated differently, and about the level of financial support. Many would be happy with another national lockdown with generous handouts.
So Keir makes his move. Seeing the opportunity to outflank the Government by siding with the SAGE scientists (who, it emerged on Monday, called for a national ‘circuit breaker’ lockdown on September 21st) and with public opinion (which continues to favour stronger restrictions, though by a shrinking margin, and often not so much in practice), the Labour leader has come out in favour of a two week lockdown.
The plan is backed by Graham Medley from SAGE and Matt Keeling from the Scientific Pandemic Influenza Group on Modelling (SPIM), who claim in modelling to be published later today that between 3,000 and 107,000 deaths could be prevented by January if the Government imposes the measure. Talk about a confidence interval!
The Spectator has published the full text of Starmer’s statement.
The number of Covid cases has quadrupled in the last three weeks. Cases may be doubling as quickly as every seven to eight days. There are now more people in hospital with Covid than on March 23rd when we went into national lockdown. And while the number of cases is rising more sharply in some areas it is increasing across all regions of the UK and in all age groups.
We know from bitter experience and great personal loss where all this leads. Three things are now clear: the Government has not got a credible plan to slow infections. It has lost control of the virus. And it’s no longer following the scientific advice.
The SAGE minutes from September 21st – published yesterday – underline this. They warn that: “A package” of “stringent interventions” is now urgently needed. SAGE also says that: “not acting now… will result in a very large epidemic with catastrophic consequences.”
They warn that: “as in the first wave… the burden of a large second wave would fall disproportionately on the frailest in our society [and] on those on lower incomes and Black, Asian and minority ethnic communities.”
Among their recommendations is a ‘circuit breaker’, a short period of national restrictions that SAGE believes would bring the R-rate down and “re-set the incidence of disease to a lower level”. SAGE’s advice is that this could set the “epidemic back by approximately 28 days or more”.
They’re very clear that: “The more rapidly these interventions are put in place the greater the reduction in Covid-related deaths and the quicker they can be eased.” The Prime Minister has not acted on this advice.
Doubling every seven or eight days.
Now where have we heard that before? That’s right, on September 21st when Witless and Unbalanced presented us with their Graph of Doom predicting nearly 50,000 cases per day by October 13th. How’s that getting on?
Absolutely nowhere near. There were 17,234 cases yesterday – roughly a third of the predicted amount – and the trend has been almost flat for a week. The Government has claimed it was the introduction of the Rule of Six on September 14th and the 10pm curfew on September 24th that has kept numbers down – the latest iteration of the “cases down, lockdown working, cases up, more lockdown needed” strategy that can never be wrong. Why then are the most restricted areas the worst affected? And why have cases started to fall in Spain without closing bars or imposing harsh lockdowns? They can’t answer that question, but neither do they seem to care anymore.
Looked at by specimen date, the curve is even flatter (note that the last four days will go up in the coming days). Has it “quadrupled in the last three weeks”? Three weeks ago on September 22nd 4,926 “cases” were reported, so the number has trebled not quadrupled in that time. Is it now “doubling every seven days”? A week ago 14,542 “cases” were reported. So it’s gone up by 19% in the past week and appears to have slowed down. Where is Keir getting his data from as it doesn’t appear to be from the Government?
Maybe “cases” will shortly start going up again, but that is no excuse for misrepresenting the current situation. Are they likely to though? Here are the positive rate curves for the UK, Spain and France, with little sign of runaway growth, so you’d have to bet against it.
Starmer continues:
In the last three weeks [Boris has] introduced two sets of far less stringent restrictions – one on September 22nd, one yesterday. Both times the Prime Minister has promised that his measures will control the virus and drive down the R-rate. But we now know this is not supported by the evidence.
We also know that SAGE has concluded the £12 billion test and trace system is only having – in their words – “marginal impact”.
And we also know that in 19 of the 20 areas that have been under local restrictions for over two months infection rates have gone up, not down. There’s no longer time to give the Prime Minister the benefit of the doubt. The Government’s plan simply isn’t working. Another course is needed.
That’s why I am calling for a two-to-three week ‘circuit break’ in England in line with SAGE’s recommendation.
A temporary set of clear and effective restrictions designed to get the R rate down and reverse the trend of infections and hospital admissions.
This would not mean closing schools. But if this happens imminently, it can be timed to run across half-term to minimise disruption. But a circuit break would require significant sacrifices across the country.
It would mean only essential work and travel. That everyone who can work from home should do so. Non-essential offices should be closed. Household mixing should be restricted to one household except for those who’ve formed support ‘bubbles’. And all pubs, bars and restaurants would be closed for two-to-three weeks – but compensated so that no business loses out because of the sacrifices we all need to make. It should also mean the UK Parliament moves to remote working.
A circuit break would also provide an opportunity to reset and to rectify some of the mistakes the Government has made. In particular to get a grip on testing and hand over track and trace to local authorities. A circuit break will have to be accompanied by extensive support for jobs, businesses and our local economies.
He concludes by pledging his party’s votes so Boris could push the ‘circuit breaker’ through by overriding his own MPs (42 of whom voted against the 10pm curfew yesterday, including Graham Brady, John Redwood and Chris Green, who resigned as a Government PPS over his opposition to lockdown).
Politically this a shrewd move by Starmer, but it is disappointing for lockdown sceptics as it reinforces Boris’s message that he is taking the middle course between lockdown and “let it rip” and will probably result in him being even stricter – as well as Sadiq Khan playing follow-my-leader and plunging London into a completely unnecessary ‘tier two’ lockdown. Boris has already conceded that he will consider a ‘circuit breaker’ if his tier plan fails.
‘Circuit breaker’? More like ‘economy breaker’, ‘back breaker’, ‘hope breaker’.
Hancock Dismisses Great Barrington Declaration
Meanwhile, Health Secretary Matt Hancock in the Commons yesterday dismissed the Great Barrington Declaration and its strategy of focused protection of the vulnerable while building up herd immunity. He repeated the now standard counter-arguments, which appear to have become Government orthodoxy.
Some have set out this more relaxed approach, including in the so-called Great Barrington Declaration, and I want to take this argument head on because on the substance, the Great Barrington Declaration is underpinned by two central claims, and both are emphatically false.
First, it says that if enough people get Covid, we will reach herd immunity. This is not true. Many infectious diseases never reach herd immunity, like measles and malaria and Aids and flu, and with increasing evidence of reinfection, we should have no confidence that we would ever reach herd immunity to Covid, even if everyone caught it. Herd immunity is a flawed goal without a vaccine, even if we could get to it, which we can’t.
The second central claim is that we can segregate the old and the vulnerable on our way to herd immunity. This is simply not possible.
Steve Baker tries to have it both ways and says the Government “must find an alternative strategic plan between the Great Barrington Declaration and where we are today”, though offers no insight into what that might be. The Mail quotes Dr Mark Woolhouse, Professor of Infectious Disease Epidemiology at the University of Edinburgh, disputing Hancock’s points, though agreeing herd immunity is still some way off.
Prof Woolhouse said: “Going forward, we would expect more people to be exposed at some stage or another and that immunity would be important, whether natural or through a vaccine. Herd immunity is the way this thing ends, one way or another, it is critical to what happens to COVID-19 in the long term. Whether he (Mr Hancock) calls it a goal or not, it will end with herd immunity.”
Prof Woolhouse described the Health Secretary’s comments about it being impossible to segregate the old and the vulnerable as a “tremendous fallacy”.
“I don’t know, or how Matt Hancock knows, it’s not possible, we have to do it to some degree because those are the people who are at risk of getting seriously ill and dying,” he said.
“We should be paying much more attention to protecting the vulnerable and elderly. I worry that that statement is impetus to give up on the idea of protecting people who need protecting. I worry that fallacy is being promoted in this brief statement.”
Ross Clark in the Spectator ably counters the arguments against immunity.
To date, the World Health Organisation has recorded 38 million confirmed cases of COVID-19. In a search of medical literature, the Nevada team found five cases of documented reinfection. If infection with COVID-19 did not give the vast majority of us immunity from reinfection – at least for a few months – it is hard to believe that it would not be obvious by now, with vast numbers of cases being recorded.
It is nonsense for Hancock to compare SARS-CoV-2 to malaria, measles and Aids – they are completely different types of virus (malaria isn’t even a virus). And we do acquire immunity to flu as well as to other coronaviruses and cold viruses, which is why they keep mutating and appear with different strains with differing degrees of virulence.
Meanwhile, Nadine Dorries MP tweeted: “There is no such thing as herd immunity.”
There is no such thing as herd immunity.
Nadine Dorries is a Health Minister.
Vaccine Hopes Fade
If we can’t become immune through infection why do we think we can become immune through a vaccine? Does the Government not understand how vaccination programmes work? That’s the question it isn’t answering. There was, however, a candid admission from Boris Johnson on Monday that a vaccine may never come, a point reiterated by Chris Whitty later in the day. Responding to a question from Steve Baker, Johnson said: “SARS took place 18 years ago, we still don’t have a vaccine for SARS. I don’t wish to depress him, but we must be realistic about this. There is a good chance of a vaccine, but it cannot be taken for granted.”
So, er, shouldn’t we learn how to live with the virus then, just as we have with seasonal flu?
Reinforcing this message, Kate Bingham, head of the UK’s Vaccine Taskforce, told Sky News last night that the first wave of COVID-19 vaccines are unlikely to end the pandemic, and that uncertainties remain over how much protection they give and for how long. Sky then went to Professor Jonathan Ball, a vaccine expert at Nottingham University, who claimed “at the moment we have no protection against COVID-19 at all” and says antibody levels fall quickly after infection so if the same happens with a vaccine it may only protect for a month or two. Has he not been following the science on T-cell immunity?
Try telling that to the Swedes, Professor.
Meanwhile, WHO chief Tedros Ghebreyesus was also dismissive of herd immunity on Monday, labelling it “scientifically and ethically problematic”. The BBC has more.
Speaking at a news conference on Monday, Dr Tedros argued that the long-term impacts of coronavirus – as well as the strength and duration any immune response – remained unknown.
“Herd immunity is achieved by protecting people from a virus, not by exposing them to it,” he said.
“Never in the history of public health has herd immunity been used as a strategy for responding to an outbreak, let alone a pandemic.”
The WHO head added that seroprevalence tests – where the blood is tested for antibodies – suggested that just 10% of people had been exposed to coronavirus in most countries.
“Letting COVID-19 circulate unchecked therefore means allowing unnecessary infections, suffering and death,” he said.
Tedros’s comments came in the same week that the WHO’s Head of Emergencies, Mike Ryan, said they want to try to avoid “massive lockdowns that are so punishing to communities, to society and to everything else”. WHO COVID-19 special envoy David Nabarro also said on Thursday that: “We in the World Health Organisation do not advocate lockdowns as the primary means of control of this virus. The only time we believe a lockdown is justified is to buy you time to reorganise, regroup, rebalance your resources, protect your health workers who are exhausted, but by and large, we’d rather not do it.”
So they don’t want lockdowns, which are disastrous for humanity and especially the poor, but neither do they support herd immunity, which is supposedly too far off, despite all the research showing lower thresholds due to T-cell cross immunity, and the evidence from countries such as Sweden, Belarus and Tanzania and the US state of South Dakota. There is also the curious case of the East Asian countries, which, as Ross Clark points out, have had far lower death rates regardless of the measures they took.
And if we’ve never in the history of public health used herd immunity as a strategy for responding to a viral outbreak, how does Tedros believe we managed to cope with the global flu pandemics of 1957-58 and 1968-69? Don’t recall a lockdown or a vaccine being part of the solution then.
Where does this leave the Government’s strategy, particularly as realism about a vaccine sets in? Nowhere at all, as far as I can see. If the new restrictions are not about waiting for a vaccine, which the Government now seems to accept is a distant prospect, what are they for? Boris has surrendered the dubious high ground of “the Science” with its remorseless call to lock everything down to Keir Starmer, leaving the Labour leader with the unanswered question of what to do when the ‘economy breaker’ ‘circuit breaker’ is over. Do another one? Then another? But by eschewing the heretical science of herd immunity and focused protection Johnson has left himself with no science at all – just a dog’s breakfast of purposeless restrictions with no hope to offer.
Until the Government accepts that more harm than good is being done by ongoing restrictions, and that we should follow Sweden’s proven strategy, we are doomed to be stuck in an endless, stop-go loop of economic destruction, where every rise in “cases” results in new shackles and every drop off is just taken as proof that the latest are working.
Stop Press: An eagle-eyed reader spotted the following nugget in the SAGE minutes released on Monday:
Overall, the evidence base on which to judge the effectiveness and harms associated with different interventions is weak and so there is considerable uncertainty around the estimates presented here.
Even SAGE admits they’re making it up as they go along.
False Positives and False Outbreaks
We’re publishing today a new piece by consultant pathologist and regular Lockdown Sceptics contributor Dr Clare Craig, who has looked at what the false positive rate might mean for care homes.
Outbreaks of Covid in care homes appear to have spiked in September in the UK. Does this mean we will see a resulting spike in deaths? This paper explores the possibility that a significant number of the alleged outbreaks in care homes could be based on false positive test results. The continuing absence of systemic cross-checking of alleged positive results against established clinical and diagnostic evidence such as loss of smell and distinctive CT chest scans remains deeply disappointing. At an absolute minimum, anyone who receives an alleged positive Covid result should be retested from scratch.
Failure to do this produces multiple problems.
Diagnosing false positive test results as cases in care homes has the effect of increasing workload for the homes, instilling fear in residents, staff and relatives and artificially boosting the case numbers. Large numbers of elderly, frail patients may well be wrongly labelled as having Covid. When this is combined with their high risk of dying anyway, it is possible that multiple deaths could be wrongly attributed to Covid. The impact of these false positive Covid cases in care homes could easily have skewed the overall data on deaths from Covid, impacting negatively on policy making.
Well worth reading in full.
Contact Tracing Worse Than Useless
Great Barrington Declaration co-author and Stanford Professor of Medicine Jay Bhattacharya has co-authored a new article on the problems with contact tracing.
Throughout the COVID-19 epidemic, public health authorities have promoted contact tracing as a key tool to combat the spread of the SARS-CoV-2 virus. Nearly every country infected by the virus has adopted some version, though with evidently mixed results given the global spread of the epidemic. Our purpose in this essay is to make the case that, contrary to conventional public health wisdom, most of the hope placed on contact tracing efforts to control the epidemic is ultimately futile. It may be useful when the number of cases in an epidemic is very small and only if it is applied aggressively without regard to privacy rights. In cases that do not fit that description, contact tracing may make an outbreak worse.
This is probably why a 2019 WHO study on measures against pandemic influenza found that from a medical perspective “contact tracing” is “not recommended in any circumstances”.
Worth reading in full.
Round-Up
- “Is Boris Johnson finally ready to challenge Sage’s coronavirus ‘group think’?” – Illuminating analysis from Camilla Tominey in the Telegraph quoting a “senior Conservative” and a “cabinet minister” saying Boris’s meeting with Heneghan et al was an epiphany making him much more willing to question the scientific advice
- “COVID-19 will probably become endemic – here’s what that means” – Good piece from Hans Heesterbeek, Professor of Theoretical Epidemiology at Utrecht University, in the Conversation
- “White House Embraces Herd Immunity in Latest Push to End COVID-19 Lockdowns” – Trump administration underlines its commitment to herd immunity and focused protection, in Newsweek
- “Sunetra Gupta interview: the scientist who says herd immunity is the answer” – The Times finally catches up with Prof Gupta. Good interview by seasoned pro Andrew Billen
- “A lockdown on dissent” – Good piece from Joanna Williams in spiked
- “SAGE advice – Whitty vs. No. 10 – Triangulation issues” – Politico‘s Alex Wickham takes us through the SAGE minutes dump. Lots of good stuff about the ineffectiveness of various measures, including outdoor mask wearing and the 10pm curfew
- “How UK ‘Track and Trace’ Data from Restaurants is Being Harvested and Sold On” – Disturbing if preditable, from 21st Century Wire
- “Corona – figures and fakery” – Latest from Sean Walsh in Comment Central arguing the Government is treating us like children
- “The Great Hysteria and The Broken State” – New book from former economist in the Government of Victoria Sanjeev Sabhlok, who quit his position in order to protest the “unrelenting attacks on human liberty in the state of Victoria in Australia”
- “Millions told to shield in first wave will not be told to stay home” – Report in the Telegraph suggesting the Government is actually moving further away from a focused protection strategy
- “Yes, Boris, this is the tipping point – for our trust in you” – Great article from Allison Pearson in the Telegraph pointing out the reality doesn’t match the fear
- “SAGE warned Boris Johnson that 10pm curfew would have ‘marginal’ effect the day before it was imposed” – From the Telegraph. So what was the point? What is Boris playing at?
- “‘Drastic rise’ in Malawi’s suicide rate linked to Covid economic downturn” – Is the Guardian starting to realise lockdowns hurt the poorest most?
- “‘The pub industry is on the verge of collapse’” – Worrying interview with a publican in spiked
- “Ignore this so-called science, the masks don’t work” – I take apart a recent Canadian study claiming masks halve case numbers in Conservative Woman
- “Overstretched – that’s how our police see themselves. So how have they found time to hound a young Geordie journalist?” – Dan Hannan in Conservative Home takes issue with the police’s investigation of Darren Grimes
- “David Starkey investigated by police for ‘stirring up racial hatred’ in Darren Grimes interview” – Another ludicrous police witch-hunt. The Free Speech Union is defending Starkey, just as it is Grimes
Theme Tunes Suggested by Readers
Just one today: “Mersey Blues” by Strawberry Walrus.
Love in the Time of Covid
We have created some Lockdown Sceptics Forums, including a dating forum called “Love in a Covid Climate” that has attracted a bit of attention. We have a team of moderators in place to remove spam and deal with the trolls, but sometimes it takes a little while so please bear with us. You have to register to use the Forums, but that should just be a one-time thing. Any problems, email the Lockdown Sceptics webmaster Ian Rons here.
Sharing stories: Some of you have asked how to link to particular stories on Lockdown Sceptics. The answer used to be to first click on “Latest News”, then click on the links that came up beside the headline of each story. But we’ve changed that so the link now comes up beside the headline whether you’ve clicked on “Latest News” or you’re just on the Lockdown Sceptics home page. Please do share the stories with your friends and on social media.
Woke Gobbledegook
We’ve decided to create a permanent slot down here for woke gobbledegook. Today, a bombshell for the campaign against Lord Nelson at the National Maritime Museum. The letter “proving” he supported slavery has been shown to be a forgery. The Mail has the details.
Horatio Nelson’s original letter to Simon Taylor is lost, presumed destroyed but, unknown to the anti-abolitionists, the Admiral had kept a ‘pressed’ copy — a sort of early carbon copy — in his rarely-seen private files, which are now in the British Library.
Comparing this pressed copy with the newly discovered document reveals that Taylor and his anti-abolitionist cronies made no fewer than 25 changes to Nelson’s original letter before they rushed it into print after the Admiral’s death to try to influence the vote in parliament.
Many of the changes were minor and editorial but overall were designed to rally the dead hero’s support for their lost cause.
In the key passage, Nelson did not write ‘against the damnable and cursed doctrine’ of slave trade abolition, as the doctored version had it.
The original wording was ‘against the damnable cruel doctrine’ and he was referring to the consequences of freeing slaves to face possible starvation and massacre in the chaos that would follow.
While a diplomatic man who clearly had no wish to pick fights with powerful anti-abolitionists, Nelson was relatively enlightened by the standards of the day.
When a young man, Nelson had sailed to the Arctic with Olaudah Equiano, a freed slave who became a hero of the abolitionists, and whenever Nelson had an opportunity to personally intervene on behalf of enslaved people, he took it.
As he did when freeing 30 galley slaves held in Portuguese ships in 1799, or employing freed slaves in his household such as Fatima, a young girl discovered in a French warship, who became his mistress Emma Hamilton’s maid.
Nelson even lent his support to a scheme, soon squashed by the planters’ lobby, to replace slave labour in the West Indies with paid labour from China.
As so often, the woke conception of “social justice” is at odds with natural justice.
“Mask Exempt” Lanyards
We’ve created a one-stop shop down here for people who want to buy (or make) a “Mask Exempt” lanyard/card. You can print out and laminate a fairly standard one for free here and it has the advantage of not explicitly claiming you have a disability. But if you have no qualms about that (or you are disabled), you can buy a lanyard from Amazon saying you do have a disability/medical exemption here (takes a while to arrive). The Government has instructions on how to download an official “Mask Exempt” notice to put on your phone here. You can get a “Hidden Disability” tag from ebay here and an “exempt” card with lanyard for just £1.49 from Etsy here. And, finally, if you feel obliged to wear a mask but want to signal your disapproval of having to do so, you can get a “sexy world” mask with the Swedish flag on it here.
Don’t forget to sign the petition on the UK Government’s petitions website calling for an end to mandatory face masks in shops here.
A reader has started a website that contains some useful guidance about how you can claim legal exemption.
And here’s a round-up of the scientific evidence on the effectiveness of mask (threadbare at best).
The Great Barrington Declaration
The Great Barrington Declaration, a petition started by Professor Martin Kulldorff, Professor Sunetra Gupta and Professor Jay Bhattacharya calling for a strategy of “Focused Protection” (protect the elderly and the vulnerable and let everyone else get on with life), was launched last week and the lockdown zealots have been doing their best to discredit it. If you Google it, the top hits you get are two smear pieces from the obscure Leftist conspiracy website Byline Times, and one from the Guardian headlined: “Herd immunity letter signed by fake experts including ‘Dr Johnny Bananas’.” (Freddie Sayers at UnHerd warned us about this hit job the day before it appeared.) On the bright side, Google UK has stopped shadow banning it, so the actual Declaration now shows up in the search results, although discussion of it has been censored by Reddit. The reason the zealots hate it, of course, is that it gives the lie to their claim that “the science” only supports their strategy. These three scientists are every bit as eminent – more eminent – than the pro-lockdown fanatics so expect no let up in the attacks. (Wikipedia has done a smear job.)
You can find it here. Please sign it. It’s now closing in on half-a-million signatures.
Samaritans
If you are struggling to cope, please call Samaritans for free on 116 123 (UK and ROI), email jo@samaritans.org or visit the Samaritans website to find details of your nearest branch. Samaritans is available round the clock, every single day of the year, providing a safe place for anyone struggling to cope, whoever they are, however they feel, whatever life has done to them.
Shameless Begging Bit
Thanks as always to those of you who made a donation in the past 24 hours to pay for the upkeep of this site. Doing these daily updates is hard work (although we have help from lots of people, mainly in the form of readers sending us stories and links). If you feel like donating, please click here. And if you want to flag up any stories or links we should include in future updates, email us here. (Don’t assume we’ll pick them up in the comments.)
And Finally…
To join in with the discussion please make a donation to The Daily Sceptic.
Profanity and abuse will be removed and may lead to a permanent ban.
1st the worst
Piers Corbyn on setting up anti lockdown groups #OurMovement Action Groups
https://www.youtube.com/watch?v=t3hC7nEp-v4
youtube com/watch?v=t3hC7nEp-v4
Is the ‘cure’ worse than Covid? Driven to despair by lockdown, two of Professor Angus Dalgleish’s colleagues took their own lives… and compelled him to join a growing rebellion against Cromwellian restrictions
Cancer specialist says he has been lost two colleagues to suicide in two weeks
One ‘killed himself as result of profound despair at loneliness created by Covid’
Prof Angus Dalgleish says focus on Covid-19 is ‘distorting healthcare priorities’
Daily Mail news/article-8824833/Lockdown-despair-drove-two-Professors-lives.html
https://www.dailymail.co.uk/news/article-8824833/Lockdown-despair-drove-two-Professors-lives.html
“Scientific Pandemic Influenza Group on Modelling” … should someone tell them this isn’t influenza?
Who says it is isn’t influenza? There is no proper evidence to suggest otherwise.
The medical definition of flu is an “Influenza like illness” or ILI. Coronavirus is definitely an ILI.
Funny, we seem to have a Deputy CMO who is a specialist in… influenza… who better to convince us that it’s absolutely definitely not that?
You’d be sickened to be second.
Great Barrington Declaration co-author:
Dr Jay Bhattacharya, co-author of the Great Barrington Declaration: “The current lockdown strategy seeks herd immunity. That is the end point. The question is how much death and suffering will there be in the meantime?”
By the way there is appalling clip of Hancock dismissing the Great Barrington Declaration
14 Oct 2020
https://www.youtube.com/watch?v=ivVuUqLDqAk
Hancock is not qualified to so arrogantly dismiss these esteemed individuals who have knowledge Hancock worked in the cesspit called the city of london before politics
Bah! Missed by a squeak
Almost!
Close…. This is worth a read:-
https://www.spectator.co.uk/article/a-medic-s-case-against-another-lockdown
Anyone got a copy of this to avoid paywall? Thanks
It’s an excellent article. Worth reading in full. Here are some bits:
‘Do no harm’ are three words all doctors must follow in the course of their work. These words make me convinced that Covid-19 lockdowns are the wrong approach, and a growing number of doctors are on my side.
…. If lockdowns were a prescription drug for Covid-19 treatment, the FDA would never have approved it.
…. In August, the Lancet published an analysis of data from 50 countries. The researchers found that full lockdowns were ‘not associated’ with decreased mortality from Covid-19.
…. if a physician were to prescribe a lockdown to a savvy patient who asked about the risks, the physician would have to disclose that depression, suicide, homicide, overdose, wife-beating, and starvation are potential side effects. Rare is the patient who would agree to take such a pill, which brings me to the other pillar of medical ethics: autonomy. Physicians do not force treatment on competent, non-consenting patients…..
Not even on the podium.
Found this from March 2020:
https://www.reuters.com/article/us-usa-stocks-shortselling-idUKKBN21811E
Someone made a hell of a lot of money just before everything shut down.
Insider dealing trials coming up?
Good thing – on the Daily Wail’s website, not one complimentary comment about Boris or Kier.
Very hostile and sceptic.
Reuters behind a paywall
I got the link by just clicking, no paywall when I tried.
Try this one:
https://markets.businessinsider.com/news/stocks/stock-market-short-sellers-billions-profit-coronavirus-economic-decline-tech-2020-3-1029022585#
There were a few memebers of US congress being investigated for potential insider dealing a few months ago for doing just this.
While this makes me feel better, knowing that people aren’t fooled it also makes this all more depressing because we still can’t change anything. I mean the casual dismissal of the Barrington Declaration in governement, simply shrugged off in the most idiotic manner indicates there’s nothing we can do. Even the WHO asking nations not to lockdown isn’t enough to compel the politicians. There seems to be no way out until they decide it is over. This has to be about something else.
Quite. As posted above https://www.youtube.com/watch?feature=share&v=R8OMTkmyKEA&app=desktop
There are things we can do. We can change things. We are going to have to give it our all. Obviously writing to MPs etc. We can also refuse to comply with the restrictions and all associated fines etc. We need to engage, persuade and explain to people what is really going on at every opportunity and illustrate why these restrictions are utterly disproportionate. I was heartened to hear about the man running the gym who said he would defy the lockdown and stay open. We need more of this type of steady defiance as well as persuasion. If we all refuse to comply, they cannot keep it going.
To me, this whole covid debacle is an illustration of how ‘the pen is mightier than the sword.’
People comply because they believe the rhetoric and propaganda.
We have to make an almighty effort to clarify, refute, reframe and persuade.
We have to get out there and engage in person, on Twitter, on the Guardian blogs where everyone believes the polar opposite to us (and where I am currently being pre-moderated for saying a week or so before the Barrington Declaration that ‘we should support and shield the elderly and vulnerable if they want to be shielded and let the young catch it’.).
It is worth remembering that they are as terrified as we are. We are terrified of the implications of this utterly disproportionate global reaction to a mild virus, they are terrified of sickness and death of themselves and their loved ones. We share this in common with them.
Hello everyone. I come here for sanity, information and comfort every day. My wifi is usually off by then tho, so I have only tried to comment once (when my guardian stuff was deleted to complain about censorship and control of the narrative by msm. I do not know where that comment went, but anyway, here i am again.
We are going to have to fight this, because it is massive and Global and there is no other way out. I have been searching for a way out for myself and my family for months and cannot see any way out. We have to meet and plan and group together. We cannot just do this online.
If we lose, we are basically leaving our children to a totalitarian prison planet digital dystopia.
I was in Homebase this morning, had a chat to 2 different staff. One of them said its like an open prison in the North and hethinks its all disproportionate. The other looked really scared and said none of it makes sense and how massively its impacting everything.
People are waking up. They are shell shocked and dont know what to do.
Did anyone see the article in the Mail yesterday about the women in France labouring and giving birth in masks. Sickening cruelty. Total abuse. Terrifying.
I hope this comment gets posted!
Another thought I had recently and wanted to post on here was this. I am not putting it very well, but in regards to making people feel guilty/criminalised for perfectly normal, human behaviour -e.g. ‘stay at home, dont kill granny,’ etc., using guilt to manipulate particularly the young for needing to socialise etc.
Frustrating this perfectly natural drive in the young to socialise is real cruelty. It will inflict a psychological wound. This precious time will not come back and its harder later…
A parallel for this guilt tripping occurred to me… despite being a Catholic convert, I am aware that in the past, Catholic teaching of sin and guilt for perfectly normal behaviour, i.e. sexuality etc was used to control behaviour. People ended up with really warped attitudes to sexuality etc.
Its a nasty manipulation.
If anyone can summarise this guilt tripping into a snappy soundbite, referencing religion that would make it easier to call out! Society nowadays is so secular that anything associated with religion is smeared by association!
Good points! It’s definitely been a very effective PsyOp. It’s become so blantant that people are seeing it for what it is.
It’s important not to feel disempowered. Passive disobedience wherever possible is a good start.
Demonstrate genuine normality – wear your smile. Look people in the eye.
Talk to those who’ll listen. They might already be awake but need to know they’re not on their own.
Quote From the Spectator article. This puts to bed any idea that lockdown is saving granny.
“ I have personally admitted dozens of elderly people to hospital with illness resulting from social isolation and neglect. Some were literally starving to death. One patient, in her eighties, lived in a retirement community but relied on family members to feed her meals. When they were socially distanced (banned) from the premises, she couldn’t feed herself and her health quickly deteriorated. Another patient, a 92-year-old woman, simply gave up on life and started refusing her meals once her family stopped coming to visit. Both these scenes were catastrophically inhumane and will stick with me for a long time. Neither is captured in the government’s Covid-19 statistics.”
These people are being harmed and killed by the government.
https://www.spectator.co.uk/article/a-medic-s-case-against-another-lockdown
The abuses being inflicted on every section of society, from imprisoning kids on their first time away from home at university to criminally denying the elderly the love and comfort of their families in their last months and years of life, as well as the smashing of businesses which often constitutes people’s life’s work, denying care to the sick… the insane incursions into every aspect of people’s lives and liberties etc etc gives me a chill… it reminds me of the abuse psychopaths inflict on their victims before they murder them…
Watch UK Column!
There is something we can do that is stop simply complying with this nonsense https://www.remove-the-tory-government.org
6th is just 5th last place… Oh, well.
1st was all that mattered to the Greeks.
Stop the lockdowns by refusing to be tested.
Do you have a fighting fund that I can contribute to?
I don’t feel like I’m doing enough, but other than hacking away at posters, I don’t know what to do for the best.
You’re doing a great job!
So Labour want to continue the trashing of livelihoods, jobs and dreams – what a surprise !
Kier is probably owned, like the idiot Tories, by the Davos set. Young people party and rebel !
Says it all along with being ex-head of the CPS.
As part of the instigatgion of the criminal Assange persecution in this role, he has already marked himself out as an enemy of the people. He is a restoration of Bliar’s neutering of the opposition, creating a one party state in Britain.
https://www.technocracy.news/trilateral-commission-usurping-sovereignty/
Can anyone help me if I’m asked at or before a job interview why I’m not wearing a mask?
I didn’t write down on my application I had any disabilities so I’m wondering if I’ve got myself in a pickle and am lowering the chance of being offered a job?
Thank you!
If you feel you have to say anything, you can use low mood.
My advice would be to present them with a printout of my discriminatory challenges document and say nothing more on the subject.
Unfortunately I think this is the wrong decision and that the only actual course of action is to wear a mask if asked to (@Jim – have they told you you need to?). Having ticked the “no disabilities” box, you’ll be on shaky ground, I would have though and showing them legal documentation at an interview is immediately going to mark you out as litigious.
If it were me, I think this is one of the very few circumstances where I would bite the bullet and wear a mask. I can’t think of another circumstance in fact.
Sadly, I agree.
There was no indication or anything about wearing a mask but, you know, these days the world has tilted on its axis!
Well, they’re not compulsory in offices, so hope for the best. Personally, I wouldn’t want to make any hiring decisions without seeing the person’s face in an interview – but then again, I’m not pro-mask.
You may very well not be asked to wear one, but I’m sorry to say that, – in my opinion – if you want the job, you probably should if they ask you to. Only you can know how much you need/want this particular job.
Thre is no disabilities box. Illegal to ask.
Yes and no. Assuming there was one, it will probably have been part of a survey relating to candidate diversity. In addition, several companies have a policy of always offering an interview to people with disabilities. As long as you aren’t obliged to provide the information, but you’re given the opportunity to volunteer it, it’s fine and not uncommon practice.
Fair enough. I just wonder why this same person is back again, having been given masses of advice by many of us previously. Perhaps he didn’t get the response he was trying for and is having another go.
I can understand the anxiety. A job interview is a stressful thing anyway and having to balance a principled stand against masks with your livelihood makes it more so.
What’s wrong with that Suey? Just scroll past. I have lost my business and am crossing my fingers for a part time cleaning job. I don’t want to f**k it up and I also don’t want to wear a mask. Have you ever asked and clarified and reclarified a question?????
I apologise, of course. Nothing’s wrong with that.
And nothing’s wrong with a cleaning job; you were the one yesterday saying “it’s only” a cleaning job. I wish you luck in your interview, and my advice stands, for what it’s worth: wear a lanyard as a courtesy and, if they ask, tell them you are exempt and explain that your inability to wear a mask would not prevent you doing the job. If they ask WHY you are exempt, reply courteously that you don’t wish to discuss it further.
Or, of course, you could wear a mask if you wish, if you think it might be more likely to get you the job; then decide that droplets and aerosols from cleaning fluids getting on to the mask are causing you issues so you can’t wear one while doing the job. Your choice entirely.
Again, I wish you luck, and please do come back and let us know how you get on.
But a disability that might prevent mask wearing (eg panic attacks, asthma) isnt one I would think of to fill in on an employment form (wheelchair user, registered deaf or blind) as under normal circumstances they would not require any special accommodation in an office-type setting.
Why not claim that wearing a mask provokes anxiety and that you’ve been advised not to wear one.
That isn’t a disability anymore than, say, an adverse reaction from taking anti-malarial medication as a preventative measure.
Under normal circumstances, you don’t have a disability. If they force you to do something unnatural, like wear a mask, then you have an adverse physical reaction.
Perfectly legitimate.
Isn’t a common qualification “the ability to work under pressure”?
Being susceptible to anxiety wouldn’t do you any favours!
Or wear a loose scarf if it less oppressive.
Asthma isn’t a disability and a valid medical excuse
Great advice but I won’t use it at an interview. Low mood: not what we want. Presenting discriminatory challenges: Stay clear this person will be difficult
You are of course right. I was in too much of a rush to be “helpful” to think it through. Employers don’t generally want people who buck authority.
I wouldn’t fancy employing anyone who put “low mood” on an application form!
Unfortunately, I don’t think anyone really considers mask exemption to be ‘real’ – it is only there as a theoretical, notional counter to hypothetical claims that some people cannot wear masks. In practice, you are expected to wear a mask, and if you don’t, some weak-minded people will genuinely wish to avoid you – not great for a job interview!
I’d say “my circumstances have changed since I wrote the application.”
In other words, I was fine yesterday, but not today!
A decent employer will be aware of The Equality Act 2010.
Ask them! Good luck.
No, it’s just a part time cleaning job!
as long as you can maintain social distance you don’t need to wear one anyway.
Maybe comply if the interview requires it and keep one in your pocket when working, in case the muzzle inspector is doing his rounds.
Hopefully this is all academic and won’t be a problem! The interview should be antisocially-distanced anyway and most cleaners work alone, so are automatically distanced.
You don’t have to be disabled in anyway to be exempt. The government guidelines make it quite clear that even “distress” from putting on and/or removing a f/c is sufficient. In fact you don’t have to prove anything to anyone, your reason for not wearing one, if you believe it to be valid. Explain you are entitled to medical privacy. If they refuse to take your application further they could be discriminating against you. Check out the LaworFiction website, as they have some excellent advice. Print out, make or obtain an exemption lanyard if you feel it gives you more confidence (but you don’t have to.) And just start as you mean to go on
But that’s what I’m referring to above. In theory, it’s a legal exemption, but in practice it’s not worth the paper it’s written on.
In theory the government should have carried a medical risk assessment of mask wearing by the general public before “mandating” it with threats of fines, but it didn’t. I wrote to my MP for this information but he couldn’t provide it, saying mask wearing was being implemented because it “may” do some good in the wider community, blah, blah. I know various organisations have asked the government directly, and again NO evidence has been provided. Therefore under Article 2 of the Human Rights Act 1998, which holds up (for the moment) against the gaslighting “rules” the government are voraciously making, they have to have exemptions, should harm come to anyone forced to wear one, which they could follow up with a lawsuit. Anyone can exempt themselves if they believe they have a “reasonable” excuse. The fines are in place for those who refuse outright to wear one, and who hang long enough to be issued with a fine. So, as you say, it’s not worth the paper it’s written on.
The exenptions are there because it’s The Governments way of ensuring they aren’t going to get busted for implementing an illegal medical experiment. They can say masks are “optional”. So avoiding falling foul of human rights law, the Nuremberg convention on medical experiments. They know this. Like people say you don’t need to prove anything to anybody or declare anything. You can just not wear one.
It’s that simple.
Do you really want to work for a bunch of charlies that insist on you wearing a face nappy anyway?
You just say you don’t wear a mask and if they ask why say you have a medical condition .If they continue pressing you say you had something personal happen to you when you were young and it causes you anxiety and you don’t wish to talk about it .
Yes. Thats right. It can also increase anxiety & you can say that you will be anxious about the interview (because you want the job – positive sign for potential employer.) and you find wearing mask makes communication v difficult. Go for trust etc.
It’s illegal for them to ask!
You again? Previous days’ advice no good for you? They can’t ask you. Wear a lanyard.
Why are you being so disrespectful and horrible?
No, maybe the advice wasn’t enough.
Maybe I need more and I need reassurance because I have lost my business and have no income at the moment.
Maybe, Suey, you’d do well to keep schtum instead of inflicting unnecessary hurt with your barbed comments and being an all round awful person needless commenting?
I’ve apologised to you further up – or down, depending on which way you read this.
Labour, Conservative and all the other MPs can simply fck off. I’m not listening get to any of them ever again and nor will I vote for any of them.
12 out or 650 voted to cancel the CV legislation. 12…..
This looks terrific:
https://www.youtube.com/embed/V6G_evJyVQ4
I’m wondering if there’s anyone on this site who could do a translated version with an English translation shown on screen. There is some technical vocabulary so it would require a German speaker with advanced skills.
You can go to settings on the video and then switch on auto-translate, which then gives English subtitles. Not perfect but gives you a reasonable idea of what is being said.
Thanks, I’ll try it and get back to this site with the result if it looks acceptable.
I just tried copy-pasting the subtitle transcript into translate.google.com, but the results were pretty bad.
DeepL (deepl.com) is far better for translations than any Google spyware crap.
Unfortunately that just produces word-for-word translation which often comes across as gibberish. I can follow it only because I know what’s being said in the original, and I think a non-German speaker would really struggle.
German subtitles only!
Hello hat man, I am a native German, watched the video.
She is presenting information which is widely available.
Looks like she is an a level student giving a presentation to the AfD political party.
The AfD is the known as rightwing party which gained a lot of seats in the Bundestag and in local parliaments in the last election and has been questioning the current policies, which is on one hand good, but also gives MSM the angle that opponents (like Querdenken) are politically on the right.
I am aware of what you say, except where you claim the information is widely available. Of course it is not made available to the public via the MSM, who would not cast doubt on the PCR test as she does. That is the point.
Whether she’s talking to the AfD or say the Revolutionary Marxists of Ostfriesland ist mir egal!
“right” or “left” is not really applicable anymore. It is systemic versus anti-systemic. Obviously, Starmer, a criminal based on his Assange role, cannot be considered to really be “left”. The person does appear to be somebody around 20 or so, and is certainly more advanced than an “a level” student, or it would not be posted. The salient fact is that debunking the validity of the testing from a sceptical perspective.
In Hancock’s speech he says: “Many infectious diseases never reach herd immunity, like measles and malaria and Aids and flu”. This show the ignorance of the man, saying malaria is an infectious disease, when it’s a parasite passed from mosquitoes to humans, but as far as I am aware not from human to human. Measles we do have herd immunity due to the vaccine, that’s how vaccines work in a population. AIDS is also not infectious in the sense that the general population can acquire it without specific behaviour patterns.
Hancock has just made the day for all those opposed to 3-in-1 injections for kids. Clearly since there is no herd immunity for measles we don’t need to vaccinate them. Since isn’t that the point of mass vaccination?
Why isn’t anyone calling him out on this idiocy?
What I’m seeing is a complete lack of understanding about science and the scientific method in general. Or theorist arseholes getting their 15 minutes of fame because they can use an exponential function.
And this is the same nation that birthed the Industrial Revolution
There seems to be a complete lack of understanding of how vaccines actually work. Numerous times I’ve seen people arguing that we have to wait for a vaccine because there is no immunity. God knows what they think a vaccine actually is – unicorn tears, presumably.
Obviously, when it comes to the Industrial Revolution, it’s worth noting that this was almost entirely driven by the “middling sort” – the political and aristrocratic elites were largely ignorant of the science then too (with the odd exception) and tended to look down on the “new money.” Hence, successful industrialists building properties like Cragside and Castle Drogo to show they were the equals of the landed gentry.
Interesting. I who loathe “stately homes”, loved Cragside. Not sure it will survive within the newly woke NT.
Quite. Lord Armstrong was an arms dealer!
Getting rid and burying
this government is vital for our health and prosperity and Labour must be permanently out of office
Here’s a Hancock worth listening to
https://www.youtube.com/watch?v=2VN8zH366M8
scary thought that music like this may never happen again
To call Matt Hancock a divot would be unfair to divots
If you watch this:
https://unherd.com/2020/10/england-has-always-been-two-nations/?tl_inbound=1&tl_groups
It’s very clear the North of England birthed the Industrial Revoloution.
Unfortunately, we are governed by a completely different country, ie the South of England.
I always thought it was rather odd that the Norman French who bequeathed us the southern English were actually French Vikings, quite different from the English Vikings who gave us the north, or a lot of it. Meanwhile us Saxons just quietly get on with things.
No it started in Coalbrookdale in Shropshire.
Indeed. For the first time in my life I am considering not attending the Remembrance Day service at my parish church. I cannot in all conscience claim to be remembering those who fought for our freedom when I am surrounded by people willingly giving up their own freedom for no good reason.
And AIDS destroys the immune system. The clue is kind of in the name…
And, given that you can never get rid of the HIV virus, by definition nobody can develop immunity to it. You either have it or you don’t have it. Another completely ridiculous example. Go Hancock!
Actually I should have said HIV not AIDS, as AIDS does not necessarily result from an HIV infection.
That’s true, do you think Handcock knows any of that though?
This came up yesterday. Honestly, I don’t know where the man is getting this crap from – it’s hard to believe that anybody who has any understanding of virology, immunology or general medicine could possibly have given him the sound bite, so I have to assume he’s made it up himself. Which sounds about right, given the level of idiocy it displays.
I’m convinced what’s needed is a more aggressive stance informed by actual science. Hancock and his ilk should not be allowed to get away with spouting this kind of anti-scientific rubbish and having it repeated by a cadre of innumerate, scientifically illiterate political journalists (and fellow ministers and back benchers). His statement is flat out wrong and he’s chosen irrelevant examples to illustrate his “point”.
Oh, and re measles – we had herd immunity a long time before the vaccine was introduced. That’s why it was almost always only caught by and passed between the very young, who hadn’t previously been exposed (and for whom it is the least concerning). Herd immunity isn’t expected to eliminate a virus, just to significantly suppress the spread. The very fact that, pre-vaccine, adult cases were rare is a good demonstration of herd immunity in action. The vaccine acts as a bolt on to try to reduce those adult cases (and severe childhood cases) even further.
To apply the same example to SARS-CoV-2, once we are at a level of herd immunity, you shouldn’t expect nobody to catch it, just that those few who do mostly won’t notice it and the occasional co-morbid patient who suffers badly from it will be indistinguishable from someone suffering similarly from the raft of ILI causing viruses already going around. The numbers will reduce, but they’ll almost certainly never disappear.
If you look at the history of mortality and measles since in England and Wales , there were around a 570 deaths a year in the 40s. But after that it had already reduced to around 90 (1958-67) when the vaccine was introduced in 1968. A lot of reductions pre vaccine were due to better food, healthcare and housing, not vaccines. There seems to be a pattern in data manipulation perhaps?
I don’t want to sit on any anti vaccine platform as everyone has a right to make their own decisions, but I know what decision I will make about a COVID vaccine knowing more of the history of development of them. Anyone interested should check out Dr Judy Mikovits.
Exactly , Engineers , Plumbers and Electricians are one of the reasons for improved health in the last century along with greater numbers being raised out of poverty. Putting this improvement in general health of the people in the western world down to vaccines is palpably false.
Exactly. waterborne diseases are still big killers in developing world.
Ironically it could have been these same improvements that precipitated the polio epidemics. Polio is spread through the orofaecal route. This was endemic but children didn’t necessarily succumb as they developed immunity as they grew up with it. When sanitation improved this community immunity was diminished leaving children open to developing the disease, there was no vaccine and there was an increased need for iron lungs. Mary Berry had polio as did Ian Drury. I was fortunate that the oral Salk vaccine was available for me.
Salk’s alturism quite a contrast to the current lot. Our star batsman at school had a caliper (and a runner in inter-school matches, he did his own running otherwise).
Interesting point! Yes I knew a few people who’d had polio. I had the vaccine, and DTAP and smallpox because that’s pretty much all there was when I was young (missed out on the BCG because I was supposedly immune to TB). IMO there’s a world of difference between a tried and trusted vaccine for a dangerous disease and a lot of the crap they pump into children nowadays. I have to wonder if that many vaccines destroy the immune system and make more vaccines necessary. Just the same scam as high carb low fat diets based on wheat, soy and industrially produced omeha 6 seed oils which make you ill so you need statins, diabetes drugs etc.
I thik you’ll find a lot of nasty diseases, diptheria being an obvious one, were already disappearing pre-vaccine because of the extensive slum clearance and council house building in the 1950s.
Endemic coronoaviruses have seasonal transmission and waning immunity. They reinfect typically in a timescale of 24mo in all but children. I doubt this one will be much different. Lifelong immunity is very very unlikely. We never had her immunity to measles, all we had was a very young age of infection and a very high seroprevalence reflecting that most people had been infected by their teens. About 9/10 people are in the same position for varicella (chickenpox). I personally believe adults who have not had it, should be vaccinated. It kills about 30 adults a year.
Quite!
I spent a large part of my life catching every cold, flu and food poisoning bug going. Then I finally learned to eat properly. In the last fifteen years I haven’t had the flu and only about two colds. Then last december I caught something suspiciously covid-like to which I evidently didn’t have much immunity but I managed to blat it without too many consequences. Hail the all-conquering immune system. Feed it well (and get out in the sun)
Have you heard of the Wim Hof Method? It’s a breathing exercise, I started doing it to increase lung capacity for sports, which it helps with, but it’s also supposed to boost the immune system.
He’s wrong about flu too. The strains that caused lethal pandemics are still around but kill very few people. If an uncontacted tribe ,say in the Amazon were exposed to flu, it would likely kill them because of no herd immunity.
Yes.
I think the reason I’m so irritated by this statement is because – in a strong field – I think it’s the stupidest, most ill-informed statement made by any public figure during this whole sorry episode.
with you there.
God, and look at the competition for that title!
He’s a cretin.
Sadly, so are almost all if those he’s addressing.
He’s an unbelievably arrogant cretin!
I would happily headbutt Hancock and the fatass dope Johnson
Press headlines this morning should have read:
“HANCOCK THINKS MALARIA IS CAUSED BY A VIRUS!”
They had a great opportunity to crucify him.
Maybe next time. (Not holding my breath)
Just as I thought
That made me laugh out loud.
How the fuck is aids or hiv infectious.
Don’t remember mark Fowler spreading it around Albert square
The sainted Princess Diana could have told you that the general population was at no risk whatsoever, and she was no Mensa member.
it’s infectious if you put the pee pee in the poo poo .
Also if infected blood is transfused into another person, Isaac Asimov was one such person.
or using dirty needles
Well, lockdown would prevent all that, eh?
I would say infection via transfusion and dirty needles is basically inoculation.
Because it’s a parasite, not a virus.
Clearly there are factual inaccuracies in his speech. How does one start proceedings for ‘Misleading the Commons’.?
How about trying to get a recall petition going in his constituency?
As some one who used to live in his constituency and now lives in the neighbouring, I say “Good Luck” …..
Parliamentary Standards Commissioner responsible for this sort of thing but not interested in doing any investigations. I tried.
The Speaker of the House might get involved if he said it in Parliament.
Response to Handsy from 2 of the 3 GBDers:
https://www.dailymail.co.uk/news/article-8836185/Matt-Hancock-says-NOT-true-herd-immunity.html
Virus experts savage Matt Hancock for claiming herd immunity is ‘a flawed goal’ and thousands will die without tough restrictions – as they say ‘after eight months it is shocking he does not have a basic understanding’
” as they say ‘after eight months it is shocking he does not have a basic understanding’”
Witty van tam vallance and tge rest are as responible for not schooling him as he is for acceoting a position of responsibility beyond his ken.
But why does he feel qualified to make this unmitigated bullshit up on the spot?
It always used to bother me during Hancock’s half hour that he would refer to clinicians in the NHS as “colleagues”. Maybe this is the answer,, though – maybe he thinks that being Health Secretary is the same as having a medical degree.
Healthtech board member Hancock.
Colleagues is a words used by hateful politicians here. Coukd he be referencing common puropse colleagues. Inclusive bullshit language.
Dr Hancock, why does shit come out of my anus, and shit comes out of your mouth?
Simple – hubris!
He’s definitely an idiot of the highest grade.
But look at the people around him, unfortunately he’s one of the brighter ones.
I think Nadine Dorreys is more clever than Handy Cock
I am not sure which of them is being damned with faint praise in that statement.
My dog is. He doesn’t spout crap from his mouth.
There is no one in this government that is intelligent,they make corbyn and dopey Lammy & Abbot appear intellectual
I can vouch for that as I have had it twice. Take the tabs for 3 days and you are OK.
DM has a great article today (surprised Will missed it) ‘Virus Experts Savage Matt HANDCOCK FOR CLAIMING HERD IMMUNITY IS ‘A FLAWED GOAL’…..
Which is most likely the reason why test/track/trace is fairly easy when dealing with STDs more generally.
No disease does reach total herd immunity on its own; it just ceases to be an ‘epidemic’. Vaccine doesn’t create total herd immunity either; the only disease that has been fully eradicated is smallpox. I think we’ve pretty much eradicated anthrax in cattle too, but by a policy of mass slaughter, which isn’t exactly appropriate in humans!!
When I was a child, there was no measles vaccine and it broke out occasionally in schools. I had it just after I started which was common; little children who had largely been at home with mothers and grannies and limited social contact were suddenly brought together in one place. Measles is seen as a “childhood illness’ but that was because adults had usually had it as children. Chicken pox, particularly, was seen as a desirable thing to have as a child because it was much more dangerous in adults.
Natural total herd immunity isn’t possible because the herd isn’t static; there will always be new people. But, if a certain level of immunity hadn’t been established to viruses before vaccines were invented, we’d have been wiped out as a species centuries ago.
Was talking about this with an old boy in my village who said as a lad he was made to play with a neighbour’s child who had measles, specifically so he’d catch it young. Imagine that nowadays! His parents would probably be sent to prison.
Indeed. When I had German measles as a child my friend’s mother sent her round to stay and she slept in my bedroom!
Oh yes we had “chickenpox parties” and probably for mumps and measles too when I was young. In my case unneccesary, just going to school gave me all three within a year. Oh God I just had a flashback to the smell of sick and Dettol in the school corridor.
Caroline,
Good summary. Thanks.
Malaria is due to a mosquito injecting the poor recipient with the wretched parasite that takes up residence in the blood cells. It is not an ‘infectious’ disease in the way a respiratory disease is. The mozzie is the carrier. Hancock seriously doesn’t know what he’s talking about. But we knew that.
The parasite is in the red blood cells, and stays there. The symptoms can erupt at any time.
Yes, my father’s from Surabaya (5th Indian Division Signals) came back from time to time throughout his 90 year life.
Towards the end of yesterday’s discussion someone asked where the “vulnerable” stand in relation to Covid. I hope fellow sceptics don’t think me conceited but I thought I might repost my reply:
We are vulnerable as a family: my daughter is having chemotherapy and a blood therapy designed to bleach her B cells plus she is on methotrexate, so all in all she is thoroughly immuno compromised, but we don’t need anyone else to curtail their existence for our safety, thank you very much. It is an absolute doddle to shield/ protect ourselves and we are worried about colds, never mind sars-cov-2.
Good for you Will, best wishes to your daughter and the rest of your brave family.
My parents (and many of their friends) are in their 80s. Rabidly anti-lockdown and think it is totally absurd. With all the “killing Granny” nonsense, we rarely hear Granny’s voice.
As ever, the “elderly” are the forgotten cohort.
Actually they’re not forgotten, they’re the excuse.
Well said! I think the more frightened ones are the 1960s boomer generation. People in their late seventies and beyond are not so bothered because they grew up in the post war era when relative hardship was the norm and you didn’t expect things handed to you on a plate. My mother, in her late seventies, has been completely calm and sang-froid through this whole nonsense, and we have been ‘interpreting’ the rules on visiting etc with a nod and a wink.
Strangely, I think the more frightened ones are the 80s/90s/00s. About as valid a thought.
My wife and myself will be 72 just before Christmas and we think exactly the same as your mother.
Absolutely. My 89 year old father is vehemently opposed and delights in sending me articles by Peter Hitchens and Richard Littlejohn.
Three loud cheers for him.
Throughout the lockdown when I went for my daily exercise I’d see several eighty years olds and beyond defiantly walking their dogs. Not taken in unlike many younger ones
I don’t see that as conceit – you undoubtedly speak for a great many people who despise what is being done effectively in their name.
My 83 year old parents feel just the same. They just want to enjoy what is left of their remaining active lives and are more than capable of judging their own level of acceptable risk.
The last thing they need is 42-year old Matt Hancock pitching up and destroying their lives on the basis of “saving granny”.
I suspect it’s because Hancock can’t understand that an 83 year old can’t reasonably expect another 30 or 40 years of life as he can.
My dad too. He’s 80, a passionate lefty, believes it’s all totally disproportionate. Speaks to his health visitor about the state of hospitals and reports back to me that they’ve essentially been empty since April. He smells a rat.
Another thing. My cousin is a nurse in Blackpool, she was giving care to a gentleman unrelated to covid, the man was tested for covid, it came out positive. She asked the doctor whether she should self isolate. The doctor replied ‘no, you can go home, it will be fine’
Go figure?
I’ve had poor health all my life and had to try and avoid infections. I am strongly anti lockdown. I wish to make my own decisions. I choose to go to church and see close friends while avoiding crowds and confined spaces. Being shut up in isolation is a living death.
Are you the only ‘vulnerable’ person with that much sense? From the way the Fascist crap merchants tslk, anyone would assume that you are.
Amazingly it’s those who are more vulnerable who create the least fuss. Once again it’s the virtue signallers causing the problems for the rest of us.
Well said. My father-in-law turned 80 this year and still lives up the Democratic People’s Republic of Scotland.
He’s fed up with lockdowns, is fed up that he can’t go to concerts, can’t go to the library to do his research and can’t really go anywhere due to the dire public transport around his area and beyond.
So much for saving the elderly but what’s being done to them is cruel.
I sympathise with your Dad. I still have library books due to be returned at the end of March; we were told to keep them ‘for the time being’.
I really miss my weekly visits to the Library, and the plays and concerts at our two excellent local theatres.
Same here. I also go to concerts and haven’t been to the British Library for months now. I will have to go at some point for work reasons but my pass is expiring and can’t pre-book tickets at the moment.
It’s a very woke virus.
And Gen Y and Z are the most vulnerable to it in that regard.
Which fits in with the general decline of educational standards and the IQ since Boomers and Xers were educated.
I wish the BBC would interview you and put you on the news instead of all the, sorry, bedwetters – can’t help it..
I’m on Methotrexate for RA, so I know what a trial that can be, let alone the other meds your daughter has to take. I too, take full responsibility for my health, and I’m avidly anti-lockdown. When did we all suddenly become so unable to have autonomy over our own bodies that the government feels it has the right to interfere into our lives and our privacy for a virus, in circulation in any other year, would hardly be noticed. Wishing your daughter well with her treatment.
In Wales, the government owns our bodies and can chop them up the instant our breath is out of them.
History repeats itself.
In 1919 the media and her controllers launched a psychological assault on the Australian population pertaining to the imminent appearance of a deadly disease that was headed for our shores, known initially as the pneumonic influenza epidemic.
The public became erratic with the media feeding the fear and the states acted not much better with all borders closed and non-essential travel ground to a halt.
https://threadreaderapp.com/thread/1308428022182109185.html
I post here regularly about brazil, no lock down got loads of stick.
Glad to say they held there nerve deaths continue to fall as do infections I said last month it will be over in brazil by xmas and I’m still saying that will be the case.herd immunity has nearly been reached.
Great news!!!
Yes it it is media were all over brazil a few months ago .nothing said now similar to sweden which is never mentioned. I think if we have another lockdown we must resist
T&T
The Australian Defence Force is trying to give itself unlimited, without time restrictions or sunset clauses, access to call an Emergency and to bring FOREIGN ARMED MILITARY ONTO THE STREETS OF AUSTRALIA.
https://www.facebook.com/AustraliansForAssange/photos/a.123927632382700/365159241592870/
It’s treason simple as
I’m still waiting for a Downfall vid with Boris in the Horseguards Bunker yelling down ‘phones with ever more insane lockdown instructions to Covid Marshal Gaulieters who either aren’t there or know the game is up . . .
Meanwhile hanckrock, witless, unbalanced and the rest of the grizzled gang are hunted down by loyalist Sceptics to face trial.
The SAGE having been listed in order of the famous Pack Of Cards with ferguson as Ace Of Spades.
As others here have noted, there is no opposition. The entire political class are complicit in this disaster, but presumably they think that they will be able to distance themselves from the damage they have caused before the next general election.
I’m hoping there will be an independent candidate in my constituency, because I don’t see how I’m going to be able to vote otherwise…
Yes either independents or the new political parties.
If you are allowed to vote again
The trouble is they think we have no choice – both sides are counting on dumping the blame on the other and assuming no third force can come through between them. We got into a similar situation in 1982, when Labour were still seen as the wreckers of our economy, but the Conservatives seemed to be making it worse – the SDP were polling at over 50% prior to the Falklands conflict. Arguably if the Argentinians hadn’t been trying to bolster their own nationalist base history could have been very different.
Agree. However they are in for a big shock. There will be enough anger and misery for voters to be disillusioned, also enough facts and court cases to use against them.
People like us will stand up as follows:
1) standing as independents or for one of the new political parties
2) vote for any party but Labour or Conservatives – ballot spoiling won’t help
I will do everything in my power to oust my Conservative MP that has failed dismally to protect his constituents. The fight is on!!!!
SDP could be an option. Or UKIP if that’s your bag.
David Kurten looks good. But he needs a party. He’s not going to be joining the SDP anytime soon. It’s all so fragmented.
Oh, interesting. Why didn’t Lawrence Fox join that?
How about a “Heritage-SDP alliance”
My MP, James Daly, has been voting against the measures recently – he was one of 42 last night. Sadly, voting for him (if ever we are allowed to) would mean voting for a party that has destroyed the country
Once the truth comes out, I’m hoping for big political upset to sweep the lot of them out.
Fingers crossed for Simon Dolans injunction hearing tomorrow, though I suspect the courts will have been nobbled
A high court challenge to the government of Spain was nobbled recently. I suspect it will happen here too. Where’s Gina Miller in all this? (joke.)
I really doubt they are worried about the next general election.
Perhaps there won’t be a next general election.
It’s been done before.
SDP I joined in April and don’t regret
I’ve been toying with joining the SDP for some time. However, I will struggle to join any political party unless it has a manifesto pledge to fully investigate and prosecute the perpetrators of the 2020 shit show.
What’s their take on the current lunacy?
I spoiled my ballot paper last time. Not sure how I can escalate that any further!
crap on it
Yes use it to wipe
How about standing yourself?
Sceptics’ party. Crowdfund the deposits. Contest every seat. Make a Coalition for Sanity with the Monster Raving Loonies.
It doesn’t need a party. It doesn’t need an election. Any one of us on here could print some leaflets and distribute them now, stating that we will stand in the next election as an Independent on the platform of being the Anti-Lockdown candidate – that we will campaign to have a full investigation, to have any current colaborator MP put on trial, to compensate those who have unduly suffered by seizing the assets of convicted colaborators – and that should put the fear of God into them!
Side two of the Urgent Action Now leaflet has some information on the Nuremberg Code:
https://www.stopnewnormal.net/downloads
‘Enforcing Covid regulations is an international breach of human rights…’
I managed to download 2 of the leaflets and now in both safari and chrome, when i click download google wants me to make an account?? i would happily print these out and give them to people, but dont want to make a google account!!
Ha! The only reason why WHO suddenly have this view on lockdowns is because of the class action suit by Dr. Reiner Füllmich and the ACU.
https://www.globalresearch.ca/germany-extra-parliamentary-corona-investigative-commission-launching-class-action-suit-against-corona-criminals/5725633
The Dr Beaker reference is superb.
On the Dorries tweet, how big is this going to be? The Twitter response is only about 99.9% against her
https://www.globalresearch.ca/medical-doctor-warns-bacterial-pneumonias-rise-mask-wearing/5725848?fbclid=IwAR33DldgoPOMIcOAAFxGHMlhWVAwMiW08Nroqr60tmUgNHc_bRBSr11GSsE
“…the fear factor has got to step back. This idea that I don’t want to give you something that I don’t even know that I have is almost at the point of ridiculous. Let’s use some common sense.”
Brought over from yesterday
LS commenter Lilli posted:
Excellent comment in the Telegraph:
Lucilla Rowbury
14 Oct 2020 8:34AM
I applaud any journalist with the integrity and courage to speak the truth. Thank you.
This is about total decimation of the economy so that Klaus Schwab’s great reset or fourth industrial revolution can be implemented. There is mounting evidence of global corruption and crimes against humanity to ensure that this new world order is brought forward.
Here in the UK, Johnson isn’t oblivious to the destruction, he’s not incompetent; Johnson is doing EXACTLY what he has been told to do.
In the coming months Johnson and Hancock will herald in this new world order (Great Reset posters already up in parts of the UK) and the gullible amongst us will think how wonderful that something good has come out of this crisis. But the more informed amongst us will realise that the virus has been used as trojan horse to accelerate the plans of one of the most ethically repugnant psychopaths on this planet.
The measures taken by our government (most governments) were never about health: it has always been about control.
Say goodbye to life as you knew it.
Say hello to totalitarianism, global government, digital currency, AI, endless vaccines, and, ultimately, depopulation.
From yesterday also. This is really important to see the globalists intention of a reshaped population is coming at us with UK Government collusion.
The Fourth Industrial Revolution’
The 2017 Matt Handcock speech you didn’t know about. On the UKGov website.
https://www.gov.uk/government/speeches/the-4th-industrial-revolution
“…And I’m delighted to speak alongside so many impressive colleagues who really understand this, and alongside Professor Klaus Schwab who literally ‘wrote the book’ on the 4th Industrial Revolution. Your work, bringing together as you do all the best minds on the planet, has informed what we are doing, and I’m delighted to work with you. …”
TT added this link to the Healthtech board of which Hancock is mouth piece. Relevant to who has been developing the implentstion of the 4th Industrial revolution. Notice it is Health which has been deliberately chosen to force this onto populations, notice too the SARS-CoV-2 carry on is a supposed health emergency.
https://tech.newstatesman.com/public-sector/healthtech-advisory-board
Also Devi Sridhar is on the World Economic Forum Council on the Health Industry. This could explain Führerin Krankie’s approach.
It doesn’t matter whether Biden wins in November or not, the UK political class will not change course and the only thing you can do is to disobey restrictions.
It’s also highly likely that Boris will try to advertise this ‘circuit-breaker’ as a thing the public has to do to ‘Save Christmas’
If you can’t tell, I am very blackpilled at the moment.
Toby / Will
Please can we have a new rule that all pictures of the right honourable Mr Matt Hancock MP are blurred out.
My mental state is precarious enough without having to see his shit-eating grin every day.
Kind regards
Mabel
I agree. Or install a wordpress plug-in that allows for scrawled defacing of pictures.
Oooooh yeeeees.
We need to launch a campaign:
Country goes into full national lockdown > all ministers, MPs, elected representatives to donate their full salaries for each day of lockdown to a fund supporting those left without jobs or businesses
Local lockdowns > same but for local MPs/representatives
Pub and restaurant closures > hospitality sector to estimate % of losses with respect to a normal year, MPs donate the same % from their salary
Then at least they’d had an incentive to keep lockdowns short.
But this will be the 3rd holiday we have missed now this year. I know it sounds like such a 1st world problem doesn’t it, but we have nothing else to look forward to. Just a week Dorset and the others were a week in mid-Wales and a trip to a mobile home in France – we’re not talking Barbados or anything flash. Just some quality respite. We arent allowed to have 1 minutes peace are we.
Quite understand. I was supposed to have a month walking across Spain in May, a week volunterring in Spain in August, visiting a friend in Spain in Sept…
So far, we’ve managed a 3 night break in the Lakes in brilliant weather in July, which my 96 year old mother trashed by having a heart attack.
I desperately need a break too.
You want a change? Try a week in Liverpool.
You know things are moving in a bad direction if people in 1st world countries stop having 1st world problems and start having 3rd world problems.
Poor you! People have lost their jobs and livelihoods but you need a holiday.
Hancock WEF speeches, meeting Gill Gates and vision for the NHS.
https://www.facebook.com/CaanageMedia/photos/a.111211127418040/118450803360739/
Dr Tedros seems to have problems forming his sentences properly
“Herd immunity is achieved by protecting people from a virus, not by exposing them to it,” he said.
What he meant was “Herd immunity is achieved by exposing people to a virus, not by protecting them from it” – What exactly does a vaccine do if it doesn’t expose you to the virus, that is how it works.
“Never in the history of public health has herd immunity been used as a strategy for responding to an outbreak, let alone a pandemic,” he also said.
What he meant was “Never in history has herd immunity NOT been used as a strategy for responding to an outbreak, let alone a pandemic,”
Never in history have lockdowns been used as a strategy either…
Where did the lockdown concept come from?
An Americans 16 year olds science project. This was then developed by her scientist father into a paper, her name appears in the paper.
Open to learning more about the origin. My answer above is what I know, I have seen the paper. However, it may not be true that this was the origin. I would like to be informed if anyone can add to this.
AOC perhaps?
Try telling that to the Swedes, Professor.
Be careful here. The rise in infections in Sweden is not that different to what was happening in the rest of Europe about 6 weeks ago. A steady increase – but very few hospitalisations. Then, as the infection spread further, we got a slight uptick in hospital cases which has now become a steady trickle.
Sweden might get away with it but they have tended to be a few weeks behind the likes of France, Spain, Italy & the UK.
Indeed. I think the evidence is very sketchy to say ‘because Sweden didn’t lock down, that’s why Covid is so low there’. There’s a lot unexplained about this virus.
I wondered if countries are recording things differently depending on their agendas, to be honest. If this situation has shown one thing, it’s that you can torture data to get it to show whatever you want, basically. Objective truth is a slippery concept.
It’s not about the amount of infections or deaths. It’s how it compares to flu season where you don’t take measures.
it’s the measures not the disease
The Swedes never said they could suppress covid, they realised it needed to be lived with sustainably over a long period, and that is what they are doing.
Regarding the data, I agree that it is hard to make comparisons. All you can really do is look at all-cause mortality as a % of population and compare with previous years in that country. To my knowledge, in every country in the world, that figure is not in any way unprecedented and is often very average. Everything else is just noise.
There is so much truth to what you say.
How many people in Britain would know anything about any epidemic if it simply wasn’t talked about and any “covid” deaths were simply put down to respiratory disease.
If it wasn’t for the constant bombardment from the news, people would be completely oblivious to anything strange going on.
I think 24 hour news and social media is part of it. An alternative virtual reality has been created in which millions of otherwise healthy people are dropping dead from Covid, and the addicted public mostly lack the critical faculties to see through it.
Because the only thing strange going on is the mockdown measures!
Yes and the lockdowns stop you going out into the real world and meeting all the people who haven’t died or know anyone who did.
Most people I talk to have no recollection of the bad flu season of 2017/8 when excess winter deaths in this country exceeded 50,000. It simply wasn’t newsworthy and so the general public remained oblivious. As did I, incidentally.
There was much scratching of heads earlier this year because no-one could understand why Gemany had such a relatively low death rate (approx 9,000 at that time in a population of 83 million) The difference was that the Germans were recording only those deaths directly attributable to Covid. Here and elsewhere in Europe, as we all know, Covid was added to many more death certificates as the cause of death than should have been the case.
German statistics provide us with a much more accurate representation of the level of mortal danger i.e not very much for most people. Even Sweden’s figures are inflated (albeit inadvertantly) by the fact that they also made the tragic error of shifting the sick elderly into care homes to create more space in the hospitals. This accounts for about half of their 5,900 deaths.
Sweden might get away with it? They’ve gotten away with it since May. It is quite clearly a successful strategy. If they’d got it wrong it would have been obvious in Summer and certainly now, there wouldn’t even have been an argument about it. The dead bodies would be piled on the streets with condemnation to follow. Still waiting…still waiting…still waiting…
The Swedes said you could only give final judgement after a year or more. So far on any reasonable measure they are doing way better than the UK.
So what if there is a steady increase in hospitalisations (I mean genuine ones – people with actual covid)? Sad for those affected, but normal. People get ill. Trying to abolish one illness at the cost of all other illnesses and normal life is futile, damaging and insisting on doing so when you know it won’t work is evil.
The virus is un-stoppable. It is mainly spread by airborne transmission and being near 1m of any infected also with facemasks risks being infected. All nations (incl Sweden) deviated from earlier practice in flu pandemics plan (all adhered to in 2019) that SD measures should have disappeared after the peak i.e May, June. Sweden despite not having lockdown still had SD which was adhered to in the beginning. Never in the world history have we had SD 6 months after the first wave. It is preposterous to think that you can adhere to SD for such long times. This can be done for a very short time period. Spain is a good example that facemasks are total useless as the natural state of humans is to mingle, even more so using facemasks as a talisman.
We all hoped that the C-19 would disappear after the first wave like Sars but unfortunately it is now a seasonal virus. Now we have the colder weather with a true second wave in all European countries. Sweden has now double hospitalizations and double ICU use compared to the nadir a month ago. But they have a bigger chance to have a lesser wave than other hard lockdown countries. There will be the day of reckoning for all European countries and worst for the ones with the hardest lockdown.
Spain is probably the country with biggest chance of reaching herd immunity this time in Europe as the pandemic is now slowing down there.
I agree with this but I would stick to ‘seasonal’ rather than ‘2nd wave’. That term has become part of the fear-porn. Will next year’s seasonal viruses be the ‘third wave’ etc. This is what the globalist psychos seem to want to brainwash us with.
It beats me why people can’t see that in October, in the northern hemisphere, you will get an increase in respiratory viruses which will continue until the end of winter. Sadly some of these people will die. It happens every year. MW
Yes. Seasonal. And we have created a monster with track and trace, health passporting, social circles and occasions destroyed, health systems at capacity for years to come, unemployment crisis, societal relationships toxified even more, break up of the UK accelerated. The list is endless. All in 8 months.
It doesn’t matter whether Biden wins in November or not, the UK political class will not change course and the only thing you can do is to disobey restrictions.
It’s also highly likely that Boris will try to advertise this ‘circuit-breaker’ as a thing the public has to do to ‘Save Christmas’
If you can’t tell, I am very pessimistic at the moment.
Same here. How will they ever turn this around or admit they are and were wrong?!
If the Fuhrer does what Starmer is saying he should do then he will look feeble, pathetic and clueless.
Mind you, he doesn’t seem to mind that too much given his track record this year, so can’t rule it out.
Feeble, pathetic and clueless.
An improvement.
Even Hitler knew what day it was unlike Johnson
If Biden wins America deserves all it gets and I hold no particular admiration for Trump either
Michael Yeadon
https://threadreaderapp.com/thread/1309793649069260806.html
Yesterday, 2 strikingly similar events tells us the oppressive police state closes in. My sister is visiting her daughter in Lincoln & loves looking after her granddaughter. Daughter & husband go out for a drink as a couple (they’re fit & well, late-20s). No pub would let them… read on via link
That is a must-read
The gaslighting is beyond insane now. No such thing as herd immunity? I thought that was the basic premise of vaccines. WHO stating lockdowns don’t work and only serve to increase poverty. What in the actual fu*k are they trying to do to us here. Obviously there is a massive transfer of wealth that has taken place and is continuing to take place but this shit is just going to keep on coming, especially while BEDWETTING retards take the bait. I literally want to rip my own fu*king head off and be done with this but that would give these power hungry scumbags what they want. Can we please, somehow, band together, rush parliament/downing street by the thousands, grab the psychopaths and string the fu*kers up on the nearest lamp posts. For fu*k sake.
Dipped into google for you, the sacrifices we make…
Top result :
Herd immunity is a form of indirect protection from infectious disease that occurs when a sufficient percentage of a population has become immune to an infection, whether through vaccination or previous infections, thereby reducing the likelihood of infection for individuals who lack immunity. Wikipedia
Next result:
Coronavirus: WHO head calls herd immunity approach ‘immoral’ BBC
Things are likely to change, and very soon. When furlough ends we could see upward of 6 million people unemployed, many with minimum or even no benefits.
When people have something to lose they won’t take risks, they won’t rebel, they wont protest.
When people have nothing to lose eveything changes for them! If you have no money at all, what difference does a £10,000 fine make to you? You can’t pay it!
Very few people have felt financial hardship up to this point, furlough has protected them from that. In two weeks time that will all change.
As a side point legally, how can the government pay 2/3 of the minumum wage?
There’s an excellent graphic here that shows the economic Armageddon that we’re heading to:
https://www.dailymail.co.uk/debate/article-8836699/Britain-not-sacrificed-altar-fighting-Covid-19-writes-Professor-ROBERT-DINGWALL.html
Won’t be surprised that when furlough finally ends, rioting will begin.
Another reason to rid ourselves of Johnson and his inept privileged entitled knob ridden crew
Proof Labour is as inept authoritarian and unfit as much as the cons and libs are for public office get rid of the LibLabConSNP now https://www.sdp.org.uk
Good luck and postive thoughts to Simon Dolan and team tomorrow.
With this speech by Starmer, SAGE have clearly made this a political argument and have obviously key members have been in discussion with and backed Starmer to push their agenda. Doris needs to snuff this out immediately or it is obvious that everyone in Westminster represents two cheeks of the same ars3. Good cop, bad cop routine – cross party can you beleive thaat.
Morning , another depressing day and things are going from bad to worse. Like I said a couple of days ago, I don’t read the articles anymore, I’m depressed enough without them. I sometimes feel like we are just like ants, screaming at a tsunami to turn back. It doesn’t matter any more, the whole political scene is in lockstep with this.The only difference is they try to outdo each other on who can impose more tyrannical living conditions. Nothing matters, no science is allowed but THEIR science. They are now saying that herd immunity (something that has been in the medical books for more than a century is a myth!!). It doesn’t matter if every single doctor in the UK tomorrow comes on television and says this is all bollocks..It will not change one opinion ,one policy, it will change nothing .And all this talk about how they will pay at the next election , blah,nblah,blah…No they wont! Nobody will pay, fucking Hanckok is going to get a knighthood for this !! We are all deludiding ourselfs if we think we can convince anybody. Fuck them! My best friend yesterday told me with a serious face that the The Great Barrington Declaration is fake scinece and a conspiracy theroy..He has 2 degrees from Oxbidge ;-( I give up, I can’t do this anymore, hey have won..I will never take a vaccine or wear a mask but that does not matter because everybody else will be queueing for days to get it..They killed the economy, sports, arts, theater, music, pubs…What else is there left of what once was a great country? Nothing but sheeple and us, the small minority screaming that the emperor has no clothes while waiting for Covid Marshals in black to kick our doors down and check our thinking. 2 years in Afghanistan, IED’s , snipe, mortars, Taliban , militias, friendly fire., landmines, poisoned water, ambushes…none of that could kill me but this surely will. I’m loosing the will to live..
Things are indeed pretty terrible, but the tide is turning, albeit very slowly. Don’t let them win.
Chin up, mate. We wouldn’t have defeated Hitler with that attitude. Despite everything that is going on right now, this is far from our darkest hour.
Sorry to hear all this and I do sympathise. Rene’s comment was quite heartfelt I thought. Here’s an idea.
Unless your MP is one of the virtuous ones (unlikely, only about 10% are), remove their wreath from the war memorial (if they have the nerve to put there), tear it up and leave it at the local constituency office with a sharp and bitter comment from an ex-soldier. I presume you are an ex-soldier?
Then put your own wreath there in its place. You are REALLY entitled to do so.
No, it’ll turn round. The will to be free is greater than the will to control other people, as Dr Vernon Coleman says.
If anyone from Sky is looking in, especially Ashish Joshi, regarding the report last night from Warrington hospital ICU.
How staged was your report?
The lady giving an interview from her bed, who had been in hospital since last Wednesday had remarkably fresh nail varnish.
The man who admitted he was overweight and diabetic, but that he felt safe to be where he was – last time I assume, because he was talking so ‘normally’ albeit wearing an oxygen mask, he would have been told to stay at home.
The old man who appeared twice in the report in two different situations. First shown in a chair fumbling with his belongings but with a tube in his nose. Second time, in a bed, looking into the camera in a full face mask, a bit like one of the child actors in a charity video.
Umh..
Did not view myself. Were they wearing shoes in bed as ICU patients were seen to be in NYC hospital during Spring, tv reports showed.
Good to remember an American network aired footage from Italy as a New York hospital in Spring too.
Fakery abounds, odd in this day and age in 21st century Great Britain. BBC Panorama Saving Syriah’s Children (not available on iplayer) has been forensically analysed if anyone wants to learn how to look for staging clues.
https://bbcpanoramasavingsyriaschildren.wordpress.com/2020/08/13/saving-syrias-children-notes-for-editors-2/
https://www.ukcolumn.org/insight-saving-syrias-children-worst-case-fake-news
Don’t forget the health care worker from Kuwait saying she watched as Iraqi soldiers took newborns out of their incubators and left them on the floor. Thus ramping up the hatred towards Iraq following the invasion of Kuwait. Except she was the daughter of the Kuwaiti ambassador and was following a script.
I’ve stopped watching TV and don’t read any of the main papers. Just can’t do it.
It’s as if my entire life I’ve been happily drinking water from the tap at home, then one day I’ve had a look inside the water tank and found half a dozen dead rats floating in it. After that, I just wouldn’t be able bring myself to drink the water from the tap again. It would make me retch.
That’s how I feel about the BBC, Sky, The Times, The Guardian, the NYT, Bloomberg, the Economist, the whole bloody lot. All of it self serving and reeking of self-importance.
Posting this again as I think it gives a true idea of what the ‘tests’ are all about.
At £10 test( a very, very conservative estimate after all costs deducted) x 215,000 a day right now ramping up to say 500,000 a day, do you think Serco have vested interest in ensuring that more positive test are turned in every day as this will result in a demand for more testing? Or should they tell the truth and put the real figure out. The same for Hancock agreeing to handing over every persons details from the NHS to these felons so they can message us to download the APP( I am sure Deloitte and all the rest of the cartel cannot belIeve he agreed to that, how about GDPR Mr Hancock, I dont need a f@ kin txt from Delottie to ask me to download the APP.). Thats the real level of the simpletons governing us, totally in the pocket of big business and they are so thick they cant see this.
More likely they do see it, very clearly, and are hansomely rewarded for aiding and abetting these measures.
All (or most anyway) the evidence in one handy article:
https://jchristoff.com/government-and-media-proven-to-be-lying-to-public-about-covid-pandemic/
Reposting this from yesterday, as an antidote to the continuing madness of the headless chickens leading us.
Jason Lenney, Premier of Alberta, Canada has announced the Government of Alberta’s policy is:
https://mobile.twitter.com/jkenney/status/1316030172148064261
Worth watching the short video/
https://www.newchartistmovement.org.uk
Guardian.
“Covid-19 may cause sudden and permanent hearing loss, experts have found, adding that such problems need early detection and urgent treatment.
“The coronavirus has been found to affect the body in myriad ways, from a loss of taste and smell to organ damage.
“Now doctors have reported fresh evidence that Covid could also affect hearing.”
Is it me or is that written with the styke of a local rag? Anyway, the subline says ‘Study team says Covid-19 patients in intensive care should be asked about hearing loss’.
https://www.theguardian.com/world/2020/oct/13/covid-may-cause-sudden-permanent-hearing-loss-uk-study
Pardon?
I SAID….oh never mind!
Gotta laugh……..
But so does flu! Loss of smell, loss of taste, loss of hearing. And in some cases these losses are permanent. Doctors should know this!!
Just to point out that if this were true (and it is, I suspect as true as the notion that Cv forces you to get on a crowded train) then face masks don’t help. Many of those with minor hearing loss (like myself) rely to some extent on face and lip reading. Masks make that impossible
I also really struggle hearing people from behind their face nappies.
Masks have a big impact on commincation for those with good hearing. I can imagine this situation being inexpressably frustrating for anyone relying on lip reading.
Masks to some are the sight of slience.
I’ve good hearing but couldn’t make out a word a masked young fellow at church was saying. Turned out he was offering me a mask. I politely declined.
I don’t have any problems with my hearing but even I struggle to hear and understand people wearing muzzles.
Maybe people THINK their hearing gets worse as people speak at their normal volume and the face covering makes it hard to understand them.
I worked in a cafe and so often had to ask people to speak up so I could take their order correctly.
Saw that earlier. Panic, panic, panic….! So does the common cold. I’ve had reduced hearing in my left ear for over ten years following a bad cold. Had grommets fitted 3 times. The list of covid symptoms grows longer by the day.
Surely it would be shorter to list the symptoms covid doesn’t cause
Sorry, can’t hear you with that mask on.
FT’s Alphaville has a very interesting article today arguing that there is natural tendency for people to control the spread of viruses by altering their behaviour to limit the perceived risks to themselves as individuals,
The article quotes the following blog which makes a similar point with plenty of detailed evidence to support it
Reproduction numbers tend to 1 and the reason could be behavioural | VOX, CEPR Policy Portal
It goes without saying that we all individuals adjust our behaviour to provide what we see as the best outcome in any situation. Epidemics are no different. In their case, however, instead of maximising our profits we make the effort to minimise our losses.
The Vox article also makes the point, at the very end, that lockdowns are probably counterproductive. They lull people into reducing the amount of effort the put into individually avoiding the diseases by encouraging them to think the Government is forcing others to do it for them.
It’s the reverse of moral hazard.
https://m.youtube.com/watch?v=VEhJDmef6U4
Anybody seen this dude?
Piers Corbyn on setting up anti lockdown groups #OurMovement Action Groups
https://www.youtube.com/watch?v=t3hC7nEp-v4
Email from my dad yesterday. Three nurses at my nan’s care home testing positive for the Rona. Obviously a bit concerned in case my vulnerable 96 year old grandmother gets it, but goes to show that lockdown has completely failed in its goal to protect the vulnerable, while simultaneously trashing everyone’s lives. Anyway, further email today saying that one of the nurses testing positive has now tested negative. THE TEST IS SHIT!
…and of course if they’d been knocked down by a bus before that second test they’d now be a Covid death in the figures.
They probably still would be as I doubt the negative test will erase the positive one in the statistics.
I was told there was a “case” in a local care home. She didn’t have any symptoms and no-one else caught it. I suspect there’s a lot of that around. These PCRs go to 11
Johnson’s response to Keir Starmer should be.
‘OK, we’ll have a short lockdown. And, as advised by the WHO, we will use it constructively. We will call in a highly experienced and successful private sector CEO to do a quick and dirty review of the NHS to establish why it ‘isn’t coping’. They will be told to look particularly at how many staff are off sick or laid off and why, the role of the unions, the influence of BLM, whether time is being wasted on ‘gender’ and other such nonsense, restrictive practices and why so many people catch Covid in hospital. They will also look at why treatment for other conditions is apparently not taking place. At the end of the two or three weeks, they will report to me and their findings will be implemented. If there is more efficiency as a result, they will be asked to do a fundamental, root and branch review of NHS management and systems once this is all over.‘
That’s what Margaret Thatcher would have done! Johnson doesn’t have the ability or the balls!
Starmer and Johnson are 2 sides of the globalist coin.This is all theatre.At the moment Boris can pose as the defender of liberty while instituting a 3 tier lockdown system from which there is no escape.
I think in a week or a bit more Johnson will ‘cave in’ to the fake pressure and put us into lockdown which has been planned for a few months.
This is not about a virus
We could save a lot of wasted time and wrangling on here if people would stop believing the politicians’ puppet-show and allow the truth in. It is not a happy process; I know because I’ve had to go through it myself.
Parliamentary ‘democracy’ is an illusion; there is no saviour waiting in the wings. The party leaders, the Cabinet, SAGE etc are all signed up, on the same side and are parroting their lines. What appears to be disagreement is a Punch and Judy show to distract us while the lockdowns continue to break our spirit and trash everything we know.
If we don’t grasp that this is about nearly every world leader implementing the WEF agenda, we’re sunk. If you don’t believe this, compare the language on the WEF website with the content of Johnson’s conference speech Other people have dug out some of Hancock’s old speeches. It’s the same stuff: 4th industrial revolution, T&T, mass surveillance, vaccines, ‘new normal’, everything that’s been there to see (if we cared to) for decades and which escalated so starkly in March under the cover of ‘Covid’. I admit I didn’t really start to get it until towards the end of the first 3 weeks and I feel embarrassed I didn’t see it coming.
We saw a ‘Build back Better’ (notice the 3 word formula) beautifully crayoned on a bridge in Keynsham back in early September and a chill went up our spines. People just don’t/won’t get what’s going on and we fear that many don’t want to.
All of us who do get it have no choice but to resist but we will need clear heads. MW
A lot of people on LS still believe in the party system. People seem to think that the SDP or UKIP could save the day. I do not think this can happen. Meanwhile, I note that the Netherlands is now toeing the line:
https://www.dutchnews.nl/news/2020/10/the-netherlands-goes-into-partial-lockdown-face-masks-will-be-compulsory/ MW
There has got to be some way out?
What must we do? How can we possibly resist this global tyranny?
All I can advise is to refuse to comply with any of it as best you can and keep telling people the truth about what is going on. This requires getting out and about. Forget social media; it is the reliance on smartphones that has helped to get people hypnotised by fear.
I can not pretend to you that what we face is easy but all I can say is, more people do seem to be doubting the official narrative now. Let’s hope this is enough to stop the process, at least this time. For some good rational scientific discussion to pass on, I recommend this video from Ivor Cummins in conversation with Dr Sebastian Rushworth, an ICU doctor from Sweden. It only tangentially hints at a global agenda but should not ‘frighten the horses’.
https://www.youtube.com/watch?v=w6IeN6sgJ3g MW
I do wish people would stop calling them ”cases”. They’re NOT. Dr Lee in the Telegraph set out quite clearly the difference between ”cases” and ”positive tests”:
”….What is a “case” of Covid? Let’s say you developed a viral cold last winter. Were you a “case” of a viral respiratory infection? On a theoretical level the answer must be yes. But on a practical, real-world level, the answer is no: you went to work and carried on with life. You were invisible to the authorities. Let’s say it got a bit worse and you saw your GP. Still no. You decided to take a couple of days off. Still no – you might show up in sick leave statistics, but not as a case of respiratory infection. If you got so far as being admitted to hospital with serious illness, you would show up as a “case” – a tiny proportion of those who actually had the illness.
”The contrast with today is clear. Covid was made a notifiable disease in February, obliging all “cases” to be reported to the authorities. Since the only way to identify Covid is with a lab test, positive tests have been equated with positive “cases”. Back then, it was claimed there were no asymptomatic cases, but we now know that 90 per cent or more of people have Covid asymptomatically. A positive test is clearly not a positive “case”…..
Do they really want to destroy everything precious that gives life meaning simply for money and power??Surely the elites already have huge amounts of money and power… I can see what is happening and what they are trying to do, but I do not understand why? Whatis the motive? What do they gain? They have everything already…
Given the apparent idiocy (or malevolence) of Nadine Dorries, Matt Hancock and the others, maybe we should try a different approach. Maybe we should pick an MP, minister or whatever, and do a mass emailing on a particular day. We might have to have a group operation, perhaps under the name of something like “They work for Pharma.”
Idiocy and malevolence seem to be symptoms of ‘Long Covid’.
N Ireland executive announcing new measures live now.
The mainland always follows N.I.
Making me ashamed of where I’m from. You would think actual measurements and calibration of tests would go on, since Ulster is known for its pedantry and stubborness.
But then we did have Eric Smyth as mayor.
This is how it should be done.
https://www.transcend.org/tms/2020/10/nicaragua-the-country-that-didnt-swallow-the-covid-blue-pill/
Dr Matt Strauss
A medic’s case against another lockdown
https://www.spectator.co.uk/article/a-medic-s-case-against-another-lockdown
‘Do no harm’ are three words all doctors must follow in the course of their work. These words make me convinced that Covid-19 lockdowns are the wrong approach, and a growing number of doctors are on my side.
Medical students throughout the West are taught the principles of beneficence and non-maleficence as pillars of medical ethics. In simple terms, they dictate that the likely benefits of our treatments ought to substantially outweigh their potential risks.
In my practice, I prescribe medications like atorvastatin to lower cholesterol, or warfarin to thin the blood, because international, randomised, double-blind control trials have proven that their benefits far outweigh their risks. If I were to prescribe thalidomide (which causes birth defects) for morning sickness, or phen-phen (which causes heart problems) for weight loss, that would be unethical malpractice; their risks outweigh their benefits. Generally, prescriptions for such medications are not allowed because regulatory bodies like the Food and Drug Administration in the US or the MHRA in the UK take them off the market once their disproportionate risks become clear.
If lockdowns were a prescription drug for Covid-19 treatment, the FDA would never have approved it. The seminal Imperial College London paper and other mathematical models like it were used to justify their use, but clinicians would never prescribe a drug or propose a surgery based on such modelling. The now well-publicised failure of these models to accurately predict Covid-19 outcomes proves the rule.
Luckily, we no longer have to talk about mathematical models. We now have seven months of real-world data to look at. Some pundits compare Sweden to Norway to argue for lockdown. Others compare Sweden to the UK, or Florida to New York to argue against. Either sort is vulnerable to accusations of cherry-picking the data. In medical science, we rely on epidemiologists to take all the available data from all the countries and perform statistical analyses to correct for as many different variables as possible.
This has now been done for lockdowns. In August, the Lancet published an analysis of data from 50 countries. The researchers found that full lockdowns were ‘not associated’ with decreased mortality from Covid-19. These are hard outcome data; reality cannot be waved away with theories or projections.
So much for the purported benefits. What about the risks? We cannot answer this question fully because a worldwide lockdown experiment has never been run before. However, evidence for the harms of lockdown is now piling up. In the US, homicides are up 50 per cent compared to last summer. In France, domestic violence calls are up 30 per cent. In Canada, almost three times more people are contemplating suicide compared to last year; and in British Columbia, overdose deaths have tripled from pre-pandemic levels. When you deprive children of their education, adults of their livelihood, and elderly people of their social connections, desperation and despair quickly set in. While a thoughtful person might have predicted this, the mathematical models did not.
All of these numbers fit with what I see in my clinical practice. I have personally admitted dozens of elderly people to hospital with illness resulting from social isolation and neglect. Some were literally starving to death. One patient, in her eighties, lived in a retirement community but relied on family members to feed her meals. When they were socially distanced (banned) from the premises, she couldn’t feed herself and her health quickly deteriorated. Another patient, a 92-year-old woman, simply gave up on life and started refusing her meals once her family stopped coming to visit. Both these scenes were catastrophically inhumane and will stick with me for a long time. Neither is captured in the government’s Covid-19 statistics.
So if a physician were to prescribe a lockdown to a savvy patient who asked about the risks, the physician would have to disclose that depression, suicide, homicide, overdose, wife-beating, and starvation are potential side effects. Rare is the patient who would agree to take such a pill, which brings me to the other pillar of medical ethics: autonomy. Physicians do not force treatment on competent, non-consenting patients. When we discuss treatments with patients, we strive to ground those discussions in the patient’s values and not our own.
I am a life-support specialist. At this point in my career, hundreds of elderly patients have instructed me not to put them on life support. Many have told me they are comfortable with their mortality and that if not much time is left to them, they would rather spend it eating ice cream or listening to music with their family, not hooked up to my machines. It is not for me or the SAGE group to tell such a person what they ought to decide. These are questions of values, not medical science, and values are personal.
It would be deeply unethical for me to put such a patient on a ventilator against their wishes. It would likewise be deeply unethical for the SAGE group to commit such a person to social isolation. I know that reasonable, educated people can decline to consent to further lockdowns because I, for myself, do not consent to further lockdowns.
This reminds me of the Charlie Guard case where the parents initially wanted to take the child to the US for treatment, then just to the house. At each stage the medical establishment were against it and got the courts involved.
At no point was the fact that at that stage medical advice was no more use than the parents’ own thoughts. At no point was it made apparent that “Do No Harm” is not the sole edict of medicine. You can do social harm which they did by preventing the parent’s have final say when all medical attempts had failed.
So it’s no surprise that the primacy of medicine is strong in this country. Or that most of these medical specialists have no fucking clue about actual science and measurement. They do not ever seem to ask “How was that measured?” before using it to drive guidelines.
Which if all the engineers took this approach you’d be dead in so many ways from the things your take for granted.
Simple really isn’t it when you put it like that? At the moment though the quality of human life seems to be irrelevant, it’s all about the statistics.
Absolutely. My grandfather, a stoic old countryman, died in the mid 80s at the age of 82. We don’t know what he died of, although his weight loss and obvious pain indicated cancer of some kind; his attitude was, ‘When your number’s up’, and he refused doctors and dreaded hospitals. On his last day, the ambulance came to take him to hospital, but was turned away on arrival because he was dead. He was determined not to be ‘messed about with’ and to die in his own bed, and that is what happened.
Many would criticise us for not insisting that he had medical treatment but he was determined to do it his way and I am proud that he did. That attitude is still there in the older generation, particularly in country people, and they should be listened to.
Good for him.
This is what my wife and I plan as well.
Yup. I have reason to believe I’m not going to live much longer and to be honest it’s a fucking relief.
If he HAD gone to hospital what would they have done? Euthenised him by starvation and called it the Liverpool Care Pathway?
Are some more people managing to join up the dots yet? I keep on asking myself, why do they want to keep on testing, testing, testing? And give people an incentive to having the test by paying them? To get the numbers up, sure. But why do they want to get the numbers up when these positives aren’t actually ‘ill’? To lock us up. But why? To cover up their incompetence? Really? By demonstrating more incompetence? And then you look at one of the most draconian lock downs on the planet, with virtually no virus at all, but the alleged reason for the lockdown and maybe you begin to ask yourself ‘surely something’s not right here? But I’ve always been reluctant to be associated with those conspiracy theorists. But then again….’ https://www.youtube.com/watch?feature=share&v=R8OMTkmyKEA&app=desktop
Here’s Hancock from three years ago too:
https://www.gov.uk/government/speeches/the-4th-industrial-revolution
I know it’s not a conspiracy but there are those reluctant to believe that what is going on can actually happen because it just seems too ‘sci-fi’ and no-one wants to appear gullible. I wasn’t sure what was going on in March but by about end of May I was convinced of it. And as every day passes, with unbelievable scenarios like that in Melbourne, it seems more and more obvious to me, yet people are still in denial. Pretty sure Toby is still in the ‘incompetence is the explanation’ group.
It’s clearly a conspiracy. What it isn’t is a conspiracy theory.
It looks to my untrained eye that the Spire of doom on the graph to-the-moon toppled forwards. The ‘forgotten/excelled’ numbers pushed into the future to lie on top of the following week.
Has there been an official announced resolution to the lost 16,000? How were they added to the numbers?
Cant help but think of that gentleman Captain Tom Moore who did that walk to raise money for the NHS……..if only he knew!!!!
Credit to him for getting up and doing something for what he believed in but shame on those who through this lockdown are probably throwing away every 24 hours the equivalent of what he raised in total.
There was also a woman aged 100 doing 500 stand-ups from her chair. That’s some farting.
Is he still walking??
A wonderful bit of brainwashing propaganda and for what a duet with Michael ball and an interview with cunty balls Piers Morgan.
Haven’t the Government used him today for some more propaganda? Advertising 1/3 off railcards for ex-servicemen? Thought he’d been made a honourary Colonel too.
I was encouraged by the article in the Daily Mail about Nelson’s letter, but I wish they would at least try to get their facts right on matters that, though not important to the argument, make them seem silly. They describe “the letter on yellowing parchment” then give a picture showing a letter on off-white paper. I suppose to the DM any type of old paper is “parchment”.
Who wrote the article, was it Sam or Liam?
This is nothing to do with a low mortality virus and The only way to predict the future is to create it.
When will tory brexiteers ( or Farage) realise that starmer/johnson dreamteam will not deliver brexit. A government of national unity is more likely.
The UK now officially a one party state from yesterday.
It’s possible that the Tories are pushing ahead with Brexit because it could make a useful excuse in the future as to why the British economy has collapsed. It wasn’t the Lockdown, it was Brexit.
https://www.newchartistmovement.org
Well according to the DM, the teams are The Sage and The Hawks.
aka The Band
Always impressive to see above the line variety, accuracy, skill and diversity. Today, finally, I can pick a hole in something.
It is written, ‘Even SAGE admits they’re making it up as they go along.’
Now, it may be subjective to say but that is one lofty ‘Even’. I suggest SAGE have mired themselves and the reputation of wider critical scientific thought from the start.
SAGE don’t deserve that ‘Even’. They deserve no repect. Particularly when one considers the evils of SPI-B.
Had an answer back from Morrison’s about their HSE breaches:
“Thank you for contacting us.
We will be following Government guidelines to keep our customers and staff safe.
Kind regards “
So I thought screw it, stir up some shit:
“Thank you for the answer even if it does not address the real issue and is quite pathetic.
Couple of points for Morrison’s legal department and top management:
1 – guidelines and guidance have no force in law in England and are unenforceable
2 – businesses must do a risk assessment of their own complete with research and proof the mitigations are appropriate, proportionate and will work as “I was just following guidelines” is not an acceptable defence
3 – Health and Safety legislation is paramount as it is an Act of Parliament and the Coronavirus legislation is a Statutory instrument.
4 – the company is putting the health and lives of it’s staff at risk due to HSE the breaches (no briefing, lack of risk assessment, lack of training and so on) I highlighted and they are now liable for an investigation and fines if any of the staff become ill and make a complaint
5 – it is not as simple a matter as saying “Government says it is law for staff to wear a mask”. Government know this and they also know about point 3 above which is why the “in close contact” is in the S.I. – the onus and responsibility now rests with the company to prove what is “in close contact with customers” by risk a assessment plus it gives the company a way out. All the company has to do is say “our staff are not in close contact with customers at any time, no masks required”.
6 – Government cannot be held to account for any illnesses or deaths of staff due to the policy as they have included a get out clause – their defence “the company did not do a full and proper risk assessment, made staff and customers wear a mask when they did not have to, ignored exemptions and so on, don’t look at us judge not our fault”.
Regards”
Found this quote today:
“Never underestimate the power of a few committed people to change the world. Indeed, it is the only thing that ever has.”
~ Margaret Meade
Sock it to ’em. I do hope they have done the necessary face fit tests too given that masking is PPE. This should be in their risk assessment. Also, there are studies/comments surfacing regarding a rise in lung/face/mouth infections and ill health from mask (or face covering) wearing. I agree that employers certainly would be liable in cases where wearing such things resulted in ill-health and, as you have stated, cannot fall back on ‘we were following guidelines’.
What I am enjoying – whatever people’s opinions – is that they are referring to source documents when coming to conclusions. Nobody, and I mean NOBODY is willing to unquestioningly accept spoon-fed info from Pfeffel.
Kier Starmer – only MP in this sitting of Parliament asked to join the Trilateral Commission.
Found this on a Labour supporting site:
https://labourheartlands.com/sir-keir-starmer-the-establishment-candidate-the-labour-leadership-race-and-the-trilateral-commission/
I guess even his own party don’t like his links to it.
FOUR people under 20 have died of covid since March without any underlying medical problems.
My money would be on those being undiagnosed heart conditions anyway. 12 young people under 35 die this way every week in the UK! That would be nearly 400 since March.
The partner of a colleague of mine died suddenly and they had to send their heart to Italy for a test to confirm. I bet they just stick Covid on the death certificate for an eastbound life in some cases.
A few years ago, a colleague in her thirties died suddenly of ‘flu. If she had an underlying condition, she wasn’t aware of it. Obviously it was terribly sad for her family but things like that have always happened. These people are trying to abolish death!
Indeed – the only ‘pandemic’ is the inability of modern man to face his own mortality.
Not sure if I’ve posted this before but it may help some people who are finding things mentally tough:
There was a study done in mice whereby one group was fed at regular intervals and another at irregular intervals, then the food was stopped. The group that was fed regularly started showing distress when food didn’t arrive as expected. The other group carried on as normal. It’s thought that the irregularly fed group just considered it the normal course of events as there would be no expectation of getting fed at any particular time.
Most people probably like routine, it provides comfort knowing things will happen as expected. Few people will like to be on constant alert not knowing what is around the corner.
So when things happen that break our routines it can be a little distressing (like for the regularly fed mice). Everything changes and if it’s a slow gradual change then we adjust with it and hardly notice. However if it’s a quick dramatic change then it puts us immediately on alert.
Consider being less regimented in life and accept that things can change. That’s not to say you can’t change back in future but maybe by being a bit more random in certain aspects of life then it may help when changes inevitably come.
I appreciate this, thank you
NI governed by psychos. Four weeks should finish their economy once and for all. I wonder if the army will be on the streets to keep order? It worked so well last time.
All bought and paid for. Treason.
So many in NI are on the State payroll that they won’t notice it and if they do, they will just bleat “Peace Process” over and over until London bungs them some more money.
The summary of SAGE minutes reviewed in ““SAGE advice – Whitty vs. No. 10 – Triangulation issues” is interesting.
… but not for any scientific insights, of which there are none in any meaningful sense.
Instead we see a group that has been mainly notable for the poor quality of its advice seeking to maintain a finger hold on shreds of credibility by rehearsing already discredited arguments whilst ducking the key revelation – that Covid was never the plague that was billed, and that focus needs to be on getting society back to normal functioning.
The issues are cloaked in the absurd ‘health’ v. ‘economy’ duality which, as we know is a false opposition believed only by simpletons and numpties.
That the politicians are – far too late – recognising that decisions are in the realm of politics is a small step forward. But the ‘neither one nor t’other’, weak footling compromise by the cabinet is not really much of an advance. We are still deeply in the mire of a deeply misconceived analysis and the damaging measures that result.
… and I note this :
“It is nonsense for Hancock to compare SARS-CoV-2 to malaria, measles and Aids – they are completely different types of virus.”
… and this is the guy who is in immediate charge of this shit-show? Totally bereft of even the most basic insight – as was shown in his ignorance about PCR testing.
Scottie !!! Where are you?
Cf my various rants on this topic today and yesterday
Who is that quotation attributable to?
It’s from the commentary on Hancock’s utterances (above)
We are but, now that Starmer has broken cover, there is a clear incentive for Johnson and the Tories to start downplaying the danger of the virus. Something which is already being evidenced in the Telegraph and Mail this morning with strong anti SAGE articles. I wonder whether Starmer will come to reject backing another lockdown, I strongly suspect he will unless we see a tsunami of deaths which you and I both think is unlikely.
The trouble is – to be a pessimist – both Johnson and Starmer now have a vested interest in keeping up perceptions of a ‘lethal’ virus and the Fear narrative, whatever actually happens.
This is a perfect opportunity for Boris to do a Sweden. Ask every SAGE member if they are in favour of lockdowns or not. If they are – sack them – they are anti-science WHO disregarding lunatics
Good point. The WHO u-turn on lockdowns is one of the few pieces of good news I have heard recently. Not because I have an ounce of respect for the WHO, but because they tend to be held up as shining beacons of truth by the globalist authoritarians who run things in this country.
Yes, I think Starmer is motivated by the opinion polls, which I personally don’t believe are representative of public opinion. Certainly there is little enthusiasm from people I know for another lockdown.
Both my parents and one of my sisters have holidays planned this week. I know they are not in favour of more lockdowns. They’ve already had to cancel holidays this year.
I sent via e-mail a clip of Nabarro (of the WHO’s) piece – in which he rages against lockdowns to Andrew Neil – over to my MP, who is a Labour cabinet member.
Despite giving him a piece of my mind earlier this year, my MP again seems to be on “speaking” terms with me and is answering my e-mails. (I have met him in person.)
It does seem to take a week or two for him to respond though, so he may not receive my latest until next week.
I don’t hold out much hope of it making a difference, but it may at least reduce his confidence in lockdowns as a policy.
Starmer has misjudged this entire episode (and the political value he can exploit from it) very, very badly. This is from someone who voted for him in the leadership election – I don’t think I’ll ever vote Labour again now.
And me. I rejoined to vote in the leadership election but left because he wouldn’t condemn the misogyny against women fighting to keep men in frocks out of female only spaces. If I hadn’t, I’d have left over this. He is listening to the public sector unions and ignoring the working class.
Yes, I think Starmer is motivated by the opinion polls, which I personally don’t believe are representative of public opinion.
They pick up the general sentiment. And several polls were virtually spot on in the last GE.
In better news Salvage Hunters is back tonight, first time since all this started. Hope it hasn’t gone ‘covid’.
I love the way it celebrates proper craftmanship and practical engineering skills. A world away from the PPE graduates and mainstream media that’s ruining everything.
Agree,it’s the only terrestrial telly worth watching.
Why sell to Drew for £1000 so that he can sell for £3000 when ebay or similar might have got you £2000? Always puzzled me that.
I also love the way Drew buys a table for, say, £50, and Alex the French Polisher replaces the legs and the top, taking 100 hours to make what is basically a new table (like Trigger’s Broom) and then Drew says ‘great, I reckon I can get at least £100 for it now!’ With a grasp of economics like that, maybe he should be in government!
Thanks for the tip – it’s one of my favourite programmes. Although I prefer the spin off series, ‘The Restorers’, as I find it more interesting to watch Drew’s old junk being restored than Drew pulling it out of sheds and haggling for it!
So there we have it, the leader of the political party responsible for so much of the shambles that goes to make up the Democratic Socialist Big State Britain of today…..intent upon making it even worse……
If nothing else, the Prime Minister is lucky in his enemies….
Yawn.
More reality denial.
Doesn’t really help to peddle simple -minded political allegiance as a diversion.
Another excellent edition of “Sceptics”. But the longer this sinister pantomime goes on, the more convinced I become that there are powerful forces in the background driving this agenda on.
Why do I say this? Because no matter what arguments and evidence is produced in places like this to show that we could go back to normal, it is all like water off a duck’s back to those in authority. The scales are hopelessly tilted against the Gupta’s and Heneghans.
And everything that the so-called “conspiracy theorists” (is anyone still laughing at David Icke now?) have warned about since March is unfolding before our eyes. “Lockdown” then muzzles, and it is obvious from what Hancock says that soon it will be coerced vsccines then health passports.
It is like they are reading off some nightmarish script that goes way above their pay grade. Freedom will soon be a thing of the past in Johnson’s shiny new technocratic dystopia.
the longer this sinister pantomime goes on, the more convinced I become that there are powerful forces in the background driving this agenda on.
Yes, I know, and woe-betide any of us who dare to take issue with this!
I wrote a huge long comment about the fallacy of this a couple of days ago.
All you are doing – whether you realise it or not – is letting the guilty party off the hook.
The guilty party being Johnson’s government.
I think some people here would be happy for Johnson, Hancock and their cabal walk free at their trial and instead rage against Bill Gates.
Thank God it’s not 1945 or Hitler could have walked away scot free.
JOHNSON AND HIS GOVERNMENT ARE LEGALLY (AND IN FACT) RUNNING (RUINING) THIS COUNTRY. NO-ONE ELSE.
You don’t exonerate the lieutenants because the generals give the orders.
I try keep an open mind – and believe me, I would love to be completely wrong about this.
As for Johnson and his cabal, don’t worry about them. Nuremberg showed once and for all that “following orders” is no defence at all.
They are definitely on the hook for the devastation that they have caused.
Mmmm … the key to Hitler’s defeat and the trail leading to Nuremberg was Russia, and the squeeze from two directions.
Where’s our ‘Russia’?
Actually – Where’s our western front??
Trump?
He’d better get on with it pretty quickly then. He’s only got until Nov 3rd. I’m afraid it’s not looking at all good for him at the moment.
Or any front for that matter. There’s not even been a Gallipoli or Dunkirk.
Couldn’t agree more. It is THIS government that is choosing to issue a plethora of regulations by edict (SIs) with no attempt to justify them evidentially still less to carry out any regulatory impact assessments. Lay the blame where it lies.
Under orders, I can remember reading that when Johnson was informed of what was on the cards, he said, ‘we wouldnt fall for it’, obviously told we/he had no choice and so the compliance began with the first obedient lockdown.
As far as I know no one on here who leans to the conspiracy side wants Johnson off the hook.
And your analogy is wrong,Hitler is the orchestrater.Johnson is a Gauleiter.Metro Mayors are concentration camp commandants
It is becoming harder to deny the attempts by such as the World Economic Forum, to capitalise on this whole nasty event. It is very much in their interest to keep us in a state of panic, so that they can push their whole Great Reset and Fourth Industrial Revolution agenda upon us.
This kind of takeover has been tried before.
In the heat of the Great Depression during the 1930s, prominent scientists and engineers proposed a utopian energy-based economic system called Technocracy that would be run by those same scientists and engineers instead of elected politicians. Although this radical movement lost momentum by 1940, it regained status when it was conceptually adopted by the elitist Trilateral Commission (co-founded by Zbigniew Brzezinski and David Rockefeller) in 1973 to be become its so-called “New International Economic Order.”
Technocracy rising : the Trojan horse of global transformation by Patrick Wood
The name might of changed but the agenda is the same.
see also
https://www.technocracy.news/looking-backward-technocrat-told-ohio-residents-in-1938-that-utopia-lie-straight-ahead/
There were lots of totalitarian ideas floating around in the 30s. It doesn’t mean they were taken seriously. Every crisis has those pushing an agenda and this is no different. Doesn’t mean they’ll get their way. Remember anything new MUST be better than what went before, or it will fail. Even the Nazis needed 14 years of chaos before coming to power. Even then that was by mistake.
I agree, the Technocracy movement lost momentum in the 40s due to the economic recovery and then the 2nd world war. But please do not underestimate the power of the WEF, they have many friends in high places. Most relevant to us are Matt Hancock and Devi Sridhar.
Whilst our main point of attack must be debunking the governments poor startegy we still need to ask #whyaretheydoingthis?
I am not laughing at David Icke. We would get far more traction with the man in the street if he hadn’t attached himself like a limpet mine to the cause. frankly if David Icke didn’t exist, the NWO would have had to invent him.
In the past I generally viewed him as a bit of a harmless crank, nothing more. And I know a lot of sceptics get annoyed with him, as they think he damages the cause, but I doubt he does much harm.
What I have noticed is that since March the government have appeared to be doing whatever they can to validate his theories.
The problem with Icke is that although he speaks a lot of sense it’s mixed up with a lot of nonsense.
I think he has got most of his accurate info from Patrick Woods work, he has been investigating “Technocracy” for years. Patrick comes across as a very sensible and sane man, unlike David.
please visit his website and also watch some of his Youtube videos.
https://www.technocracy.news/
Just summed up every conspiracy theory ever there! Thank you
David Icke has been earning a decent living for years, most of his ‘research’ is just copying other peoples work. So Icke has been right about some of what he says, but tends to pad out with a lot of BS. You are right that his envolvment does not help the cause.
Yes, I’m still laughing at David Icke. Sorry if you’re a fan.
That Mark might be a fan, but I’m not. And I’m the usual Mark here.
I’ve not read Icke’s scribblings other than what I’ve seen reported, but the “lizard people” thing which is often used to discredit him could have been a figure of speech and not meant to be taken literally. Similar to the saying about Trump: his supporters take him seriously but not literally, his opponents take him literally but not seriously.
I’m all for Lockdown II provided all the public servants will donate their salaries to the private sector and business owners for 6 months. So no money for you great “servants” of the people. So noble. So stunning and brave.
Also politicians should bring a sleeping bag and stove for prolonged living in the Houses of Parliament.
Rishi has tried to help but the effect of free money is just to make people happy to lockdown
They will keep reducing it, until the out of work have a, what they believe to be, a sustainable level.
All valid arguments, the whole thing is middle class (full or large % of pay) to work at home online as against working class impossible to work from home as plumber,builder,van drive, shop worker etc etc. I suppose you could say NHS workers can’t work from home either. Frankly though I am so sick of the masses of “Health workers” happy to go along with this charade I honestly want to throw a brick at houses with the thank you NHS signs on them. For context I am a 54 year old female who is not usually violent!
My missus is a nurse and also does agency work. While I don’t want to bite the hand that feeds me, a wake-up call needs to be made and the best place is in the pocket.
A lot of people who have always worked in the public sector or who are permanent employees have no idea what it means to build a company or small business. Which consists of something like 80% of our economy.
Madness.
The NHS death cult rainbows
To be fair, a lot of those rainbows are looking distinctly shabby and faded now, and many have been taken down. In my village a lot of them got replaced by VE Day 75th Anniversary decorations. I haven’t seen any new NHS decorations for a long time.
I despair at those falling into the Johnson ‘divide and rule’ trap of setting up the bone-headed duality of public v. private. It’s as stupid as falling into the Fear trap.
A good point but it does stick in the craw that NHS staff had discounts and preferred shopping hours while delivery drivers ( many of whom will have young families) get nada! I don’t have delivery drivers among my friends and family but I can clearly see when some get the shitty end of the stick.
Remember ‘the great reset’ proposed by the World Economic Forum. This is what they want, less travel for the plebs, guaranteed government income, crippling taxes to pay for it.
I think we should all use this form to ask Wankcock how he thinks malaria and AIDS are the same as measles and covid-19:
https://contactus.dhsc.gov.uk
Put my questions in, they give you 3000 characters so you can let rip:
Mr Hancock, our illustrious Secretary of State for Health said yesterday in his speech about herd immunity that “Many infectious diseases never reach herd immunity, like measles and malaria”.
Malaria is caused by an infected mosquito biting the individual and cannot be passed human to human.
Can he please explain to the nation how malaria and AIDS are similar to flu and how herd immunity does or does not works with them?
This one statement shows how ignorant he is of medical or science matters and is unfit to hold the position he is in.
Can he also explain the following:
1 – Department of Health and Social Care Reference FOI-1240596 answer stated that a positive PCR test means nothing medically.
The actual quote: “SARS-CoV-2 RNA means the RNA is present in that sample at that point in time. It does not mean that the patient has the novel coronavirus (COVID-19).”
So why the continued nonsense that a positive test warrants shutting down huge swathes of the population and economy?
2 – Department of Health and Social Care Reference FOI-1240596 answer gave a link to a document that in conclusion stated that the PCR tests being used are unreliable, had high false positive rates, could not be verified against an actual confirmed case of covid-19 and had not been verified in a medical or hospital setting.
So basically as admitted by the DHSC answer Reference FOI-1240596 you are using tests that are “unreliable” to say the least, have no reference standard to double check the accuracy against and that have results that means nothing medically.
So why the continued nonsense that a positive test warrants shutting down huge swathes of the population and economy?
3 – A quote by CMO Whitty on 21st July 2020:
“If you look at the R, and the behaviours, quite a lot of the change that led to the R going below one occurred well before, or to some extent before, the 23rd, when the full lockdown started.”
So why the continued nonsense of increasingly totalitarian, draconian and nonsensical restrictions being imposed and the shutting down huge swathes of the population and economy when it has been shown that more frequent and washing with soap and hot water, cough and sneeze etiquette and staying at home for a few days if you feel ill was working prior to March 23rd 2020?
4 – Nowhere has it been shown, no real-life studies show that one the past 2000 years of human history lockdowns work nor does mask or face covering wearing work to stop the spread of a virus.
Why does he and his team of “experts” believe they will when virtually every independent researcher and scientist worldwide who is not connected to Government teams or groups or the vaccine industry is proving they do not?
I look forward to Mr. Hancock’s answers in the national media and Parliament soon.”
I attached the FOI answer referenced for him to read and digest.
Between them Sunak and Starmer have shot poor Boris’s fox. He wanted a circuit break now so he could end lockdowns in December to a fanfare of “Boris saves Christmas” headlines. But Rishi put his foot down on that one so Starmer has started agitating for a circuit break lockdown at half term. If Boris caves and introduces one Starmer will (assuming it works) then claim he was the one who saved Christmas.
Note: I’m assuming nobody reading this believes that a circuit break will do anything other than kick the can down the road. We may be released from our hovels on Christmas Day to play socially distanced football on the boarded up high street before being chased back into our homes by the covid Stasi where we shall remain locked down from January through to at least March!
Depending on what you think the ultimate goals are, this will either go on until there is a vaccine or forever (and a vaccine may take forever).
Yes. The goalposts have been constantly changed. First things were going to be back to normal in three weeks, then twelve, then by the summer, now it’s all ‘2021’ which is gradually moving further away as well. People don’t seem to realise that the machinery is in place for this to continue indefinitely now. It’s a ‘heads I win tails you lose’ situation.
I think a lot of people are still expecting to go back to “normal” one day, just not as soon as they first thought. It hasn’t really sunk in yet that this is it, forever.
The full transcript of the Dr Reiner Fuellmich video on Crimes against Humanity is available here:
https://www.globalresearch.ca/video-crimes-against-humanity-the-german-corona-investigation/5725795
I don’t think this should be trusted. I mean what would the Germans know about mass subversion and treason?
Peter Hitchens “on fire” this morning:
My projections on the British economy suggest a short ‘circuit-breaker’ in which all Ministers and MPs who have failed to oppose this destructive madness should be put on Universal Credit for the rest of their natural lives.
Hancock and Johnson *are* letting unemployment rip. Hancock and Johnson * have* let cancer and heart disease rip. Hancock and Johnson *have* let family separation and callous cruelty rip. Never forget it. Justice will eventually catch up with these buffoons.
Please could you provide a link to this?
On PH’s twitter: https://twitter.com/ClarkeMicah/status/1316290197823401984
Superb. Where was it – available yet online?
Personally, I would confiscate all their property and sell them and their families and their children to the fourth generation into slavery.
On what forum was he speaking
A student that I teach has called in sick today with COVID symptoms and is awaiting test results. The ironic thing is that this student wears a mask all day (SE Asian background), in all classes (the only one in my classes that does) and outdoors as well. The mask that she generally wears is one of those tight fitting black ones (with no gaps around the edges). The student sits away from the rest of the class in the classroom.
I wonder how many more of these cases are around that prove that mask wearing is useless?
I am actually beginning to think masks actually spread the virus even more. If Covid is spread by droplets from the mouth, then constantly touching your face to put the mask on and off then touching doors, supermarket items, surfaces etc, then a person with Covid is actually spreading it more? I’m no scientist but just a thought!
Here’s the thing. We strongly suspect masks don’t stop the virus, or at best have a small effect. However, people wearing masks simply don’t anti-social distance at all. Comparing the two stupidities, I’d say ASD would be more effective – though in the overall scheme of things, only marginally – than face nappies. So the nappies probably do lead to more infection.
Carehome work friend has been sent home with sore throat. Told to carry out the test themselves. Cannot return to work without positive test.
They themselves blame the Flu shot. Two weeks off in isolation? No. Just as soon as the Covid test comes back negative they can return to work, with the Flu…?
Utterly blind nonsense
You’d be better off not having it. I’d like to know the percentage of people becoming sick after having the flu vaccine. I’ve never had the flu and I would certainly not have the flu vaccine!!
It’s more power to the governments elbow, more throat and chest infections the more they can impose authorianism. Stop wearing masks is the only answer. Politicians only wear them in front of the cameras!
I’d be most interested to know the political leanings of all members of SAGE and not least Graham Medley and Matt Keeling from Scientific Pandemic Influenza Group on Modelling (SPIM). After today, I think we can all guess.
Their political leanings are not the issue. As we know, traditional political definitions are beside the point in this shit-show. It’s to do with much more personal character flaws, real-world experience and grounding in scientific rigour.
Agreed but I think it’s interesting these two seem to be tag teaming with Starmer.
And the UK’s tragedy is the scientific illiteracy of the political class.
One member of SAGE is a registered Communist Party member
I know about her.
A common definition (often attributed to Einstein but disputed) of insanity is that it is repeatedly doing the same thing & expecting a different outcome. We have had a national lockdown, local lockdowns, local restrictions, the three tiers, masks & hand sanitiser everywhere & social distancing. Now we have the proposed ‘circuit breaker’, which no doubt is only a matter of days away. Nothing has stopped the spread of the virus. Are these clowns insane or am I? Nothing has stopped the spread of the virus or is likely to do. It is here & we cannot ‘control’ or ‘defeat’ it. We just have to learn to deal with it in a sensible way & get on with life as with every other virus. I despair.
Mr Bee, you’re not alone. I’m tearing out what little hair I have left over this madness.
Once you accept it’s not about a virus then it is easier
The virus is just a smokescreen at this point.
Being seen to be doing something.
William Farr was right all those years ago. Basically the virus has followed a Farr curve everywhere wih some variation probably according to local factors. Meanwhile we are told that the lockdown worked so well that we need another one, which obviously means the lockdown DIDN’T work. And they tell us facemasks are our salvation despite the infection rate, sorry positive test rate, increasing since they were mandated. So obviously we are not yet wearing them in enough places, everywhere outdoors will be next, then in our homes, then there are gloves, and goggles . . . Hope Simpson was right as well looking at vitamin D vs seasonal infections like flu. So much real knowledge squandered in the face of an agenda.
Hat Mancock (as someone mispronounced him) is still following Ferguson, lock down and wait for the vaccine to save us. Covid zero, carbon zero, human zero
Fellow skeptics,
As of last night, Holland is no longer a country that values its freedom. Because of a highly doubtful increase in “cases”, the pubs/bars/restaurants/clubs/theaters in the whole country will be shut down completely, for at least 4 weeks. Some major carnavals scheduled to take place in 2021 have already been cancelled! This has never happened before, including during the German occupation! Most controversially, and one issue where I admired the Dutch stubbornness, masks will be made compulsory when legal technicalities (i.e. a small thing called the Dutch Constitution!) are dealt with.
Shops have already started to implement the ” law”, although it was specified that it is not legally enforceable yet. Any fellow Dutch residents can comment on this? Is there any workaround, like the exemptions in the UK? Or are we headed either for an exclusively online (me) or zombielike muzzled experience?
I read on Monday as headline from the Independent, I think, that The Netherlands want to follow Belgium and not make policies on account of positive tests. Must have beer wrong then.
Sad.
Funny how all the incompetent
Governments around the world want to cover up their incompetence with the same 4 week lockdown.
The Scientific Panzer Influenza Group has a moot point, in my opinion.
Certainly, 3000 early deaths among the Covidites, Lockdown Luvvies and Great Resetters would save the lives of 107,000 everyday citizens, if not far more.
Another passing thought.
The key policy issues – all except masks – are well covered in today’s issue. Well done for that ‘sticking to the knitting’.
The review is interesting in revealing what an utter failure government and SAGE have been, creating the worst of all possible worlds, whilst the virus has managed its own fate unhindered.
There is nothing touched on (above), from lock-ups, through T &T to vaccines that have not been woefully (and wilfully) misconceived.
… and yet the insanity (as defined by Einstein) continues unabated, with irrelevant spats about what degree of uselessness should come next, and the opposition and media joins in to play the same game of ignoring the key fact – that the emperor is stark bollock naked.
‘that the emperor is stark bollock naked.
I always thought that King Canute was fully clothed?!
For anyone who missed the breakfast posting:
Ian Brown
·
18 Sep
NEW TRACK LITTLE SEED BIG TREE OUT NOW PLEASE SHARE
https://ditto.fm/little-seed-big-tree
https://youtu.be/gOHn6KurHE0
Ian Brown earlier gave support to Liverpool:
BiG UP LiVERPOOL! they know full well if they can break you they can break anywhere! #STANDFiRM #ONELOVE
https://mobile.twitter.com/ianbrown
Quote of the day so far from my 15 year old son. “That labour leader guy is a complete numbnut with a capital N”. Made me smile on an otherwise depressing day.
Sums Starmer up very concisely.
They’re all numbnuts in my view!
Reason to be proud, excellent parenting! One of my proudest moments was my 16 year old daughter’s comment when Blair became PM “He’s creepy”. Spot on and prescient.
Starmer is playing Mr Nasty to Bozo’s Mr not quite as Nasty, This allows the Tories to introduce all kinds of infantile measures and still appear to be reasonable. Well done Starmer. Does he know what he is doing and if so is he just an establishment placeman who has been imposed on Labour?
“is he just an establishment placeman who has been imposed on Labour?”
Not so much ‘imposed’ as finessed.
Anyone who’s been awake (i.e. immune to MSM narratives) over the last few years, the media assault on Corbyn was unprecedented in its dishonesty and deviousness. It was obvious that it was co-ordinated, and originated in common establishment sources.
The campaign came to fruition at the last GE, when it was obvious that Corbyn would have to go.
Whilst we can argue about Corbyn in terms of leadership qualities, and even the fairly ordinary centre-left policy agenda , the real problem for the establlishment interests was that he was not captive – and had had remarkable success in re-invigorating the Labour Party as a genuine, wide, member-based political entity (against the wishes of an administration still influenced by Blair and establishment connections).
All this was dangerous to establishment interests – and so – long story short – we now have Starmer as a safe pair of hands in these terms, leading a compliant PLP still very much in thrall to the Blair era (like the administration of the Party) , and lacking individuality and muscle.
Thus the net result : no opposition – just a safe alternative should the plebs get restless.
Corruption in Government? Who’d a thunk it……….this is what’s commonl;y known as taking the p*ss
https://www.youtube.com/watch?v=LnrSpCO6dWM
Brilliantly searing comment from Allison Pearson’s article mentioned in the roundup:
Indeed.
That would be much more sensible policy for sure!
Just as Sweden shows us that lockdowns are fundamentally stupid, so Japan gives the lie to those who say it is impossible to protect the elderly.
‘Japan has recorded 1,225 deaths from covid-19, the disease caused by the coronavirus, compared with about 180,000 in the United States. In Japan, 14 percent of the deaths have been in elder-care facilities. That is compared with more than 40 percent in the United States, despite a lower proportion of U.S. seniors living in nursing homes.
Fewer than 1% of Americans live in nursing facilities, compared with 1.7% in Japan.’
How do they do it?
‘Japan’s elderly care facilities have taken great care in protecting the elderly, not just from this virus but from norovirus, influenza and other germs.’
‘…the idea is to keep the infection out in the first place.’ (!)
‘Access to the second floor, where residents live, is very closely controlled, with even close family members excluded’
“The very basic principle of elderly care is washing your hands at each step of your work: Take care of someone, wash your hands, do another job, wash your hands. But now it is even more thorough.
Perhaps surprisingly, staffers don’t usually wear face masks. It makes it harder to communicate with elderly patients who may be suffering from dementia.’
‘….huge debt of gratitude to staff members who have basically put their own lives on hold so they don’t bring the virus in….’They have hardly been anywhere else except here, and just commute between their homes and work,”
‘“We tend to have less diabetes, less obesity, and these kind of risk factors seem to be heavily related to the severity of the disease,”
https://www.washingtonpost.com/world/asia_pacific/japan-coronavirus-elderly-death-rate/2020/08/29/f30f3ca8-e2da-11ea-82d8-5e55d47e90ca_story.html
Hmmm…….nosocomial infection and co-morbidities absent……..this is not complicated…
At the very least, the state health service should consider voluntary BCG vaccination for the elderly:
‘In addition to the clear effect of BCG vaccination on infections in general, the most important observation was that BCG could mainly protect against respiratory infections: BCG-vaccinated elderly people had 75% fewer respiratory infections than the elderly who received placebo.’
https://pubmed.ncbi.nlm.nih.gov/32941801/
All well and good in its own way. But do we really want to deprive elderly people of family contact, hugs and kisses on a permanent basis? Won’t that demoralising state of affairs impact negatively on their health, often hastening their demise.
Yeah. That’s the thing for me too. It should really be a decision for them too. Of course it should.
I think a lot of the problem stems from the fact that middle aged (and younger) policy makers assume that elderly people with co-morbidities and/or dementia in care homes are ‘just like them’. They don’t understand that somebody in that condition cannot, like them, reasonably expect another 30 or 40 years of life so there is no point ‘protecting’ them if it makes their lasts months or years miserable.
Why does Will Jones again repeat the bullshit that the polls show the public want stricter measures and more lockdown ? It’s a good job i’m not in the conspiracy camp because i notice he repeats it often along with a increasing number of defeatist commentators on here . Everyone knows polls have been way out on Brexit and the last former elections both here and places like America and Australia ,me and others have pointed out on here that with over 5 million public sector workers and many others on furlough the chance of an extended or new holiday with pay is appealing and are surely the people voting in the polls. I don’t personally know one single person ,even the pro mask people iv’e spoke to who say they want another national lockdown .Are you your family and friends clamouring for one ? because i can’t see it . And even supposing i’m completely wrong and most people did want it ,why on earth would we repeat it and propagate it ? Imagine you’re back in world war 2 would you keep saying the Germans are winning and everybody supports them and its all doomed ,no of course you wouldn’t .What you do is encourage your own side . We need to stop the game playing because things are serious and the freedoms that generations fought and died for are being stripped away so lets stop being defeatist because giving up is what the other side want .Everyone of us needs to decide today either in small groups or as individuals what we can do to further the cause and end the lockdown .Whatever you do will be a help and make us stronger and will take away the gloom and make you feel better. So come on chaps and ladies lets make future generation proud of us .so that when our grand children living in a free society look back on us ,they remember with tears in their eyes and pride in their hearts that we against all odds never gave up or gave in .
so today went to Aldi. Not masked of course. Noted a notice not to buy more than i needed (don’t panic buy). Everyone masked. My favourite assistant on till unmasked and agreeing it is all bullshit.
Then went for a walk. Passed the test centre they have set up in the car park to the country park. Fence all the way round. Walked from the footpath up the steps to car park to have a look. A constant stream of cars coming in. Drivers being tested. If you are fit enough to drive you aren’t ill!
Then i attracted the interest of the bouncers. In black with yellow jackets. Bear in mind i am some yards from the fence which is 30 yards from where the activity is taking place, and on public land.
Lady comes over .. Asks if i have come for a test. I said no . Asked what i was doing there? Just having a look. This is private. No, its a public park. People are having tests. I know!.
She didnt know what to do. Turned around walked the 30 yards back to the main entrance muttering to her colleagues.
They are very sensitive about this aren’t they?
Lol do not look behind the curtain!
Yes very touchy indeed, it seems to be pretty universal. These test centre people have a lot to hide and they know it.
People are incredible paranoid about being filmed and nearly everybody thinks it is illegal to film people in a public area. It’s not.
I used to hear a lot about this in my old life as a drone enthusiast. Actually there was strong anti drone propaganda before the government brought in some swinging new laws that pretty much shut down all flying of model aircraft and drones.
It got so bad that I would be harassed for legally flying my drones just about everywhere from the brainwashed sheeple. “ARE YOU FILMING? YOU CAN’T DO THAT”….
I actually just gave up trying to fly them as did almost everybody that I knew who was into them as well. the new rules totaly killed what was a very interesting SAFE and fun thing to do enjoyed by thousands of people.
The new rules introduced statutory instruments with fines if you did fly anything over 250 grams in weight without a “licence”.
All this was done in the interests of safety but there have been almost no accidents that resulted in injury with drones or model aircraft. One or two death involving model helicopters when people flew them into their heads/necks and a fair few drone/face propeller/fingers incidents but certainly no real risks to real aircraft.
The drone debacle was like the covid meltdown in many ways. The public propagandised to hell then tons of stupid laws brought in on the back of the brainwashing.
Yes, I remember the “Gatwick drone”. It was never found, and if it existed at all, it’s a dead cert it was a police drone. And remember how the scum dealt with that totally innocent couple?
That was a massive hoax to cover up for a crash in the airports critical booking baggage software that would have cost the airport operator a huge amount of money. They fabricated the whole thing and ALSO huge contracts were paid out to a few companies for anti drone defence systems, of which we hear NOTHING about now. Sounds familiar?
This kind of thing:
https://www.gov.uk/government/news/dasa-awards-2m-contracts-to-counter-hostile-drone-threats
What they really wanted was a pan European track n trace mobile phone app drone surveillance system they called “Uspace” where you have to log into to mission command and submit your flight plan then this flight plan would be authorised by central HQ. All other users of the airspace under 400 feet would then be notified of your drone “mission” and also you would be ordered to land your or “abort your mission” if say an air ambulance or police helicopter was operating in your area.
A totally mental solution for a non problem. Sound familiar?
As far as I know this mental “uspace” thing has fizzled out and come to nothing.
Also the privatisation of the lower airspace was very much the goal. Charging for priority acess to the lower airsoace to say Amazon or Pizza hut for drone deliveries.
I said many times to my fellow dronsters that this was Tyranny and that people should not register thier aircraft and not comply but EVERYBODY did.
Now the hobby is almost decimated.
Not to mention that a drone weighs much less than a goose or other bird. And aeroplanes are built to deal with them.
Err, aeroplanes can usually (but not always) ‘deal with’ birds yes, but often with significant cost due to inspection/repair requirements.
I heard a hysterical but almost certainly untrue story, they fired a chicken from an air cannon into a newly developed aircraft. It shot through the windscreen and embedded itself into the back of the cockpit. Next time they decided the chicken shouldn’t be frozen.
Bird strikes usually involve more than one bird, but one with any size to it can destroy a jet turbine. It only needs to break one blade to trigger a chain reaction and force an engine shutdown
Yeah, drones became public enemy number one, which culminated in a case of mass hysteria at Gatwick. It was quite interesting talking to people who had become so afraid and paranoid about them, but actually had no knowledge of them, apart from what they’d seen in the media.
When I took time to explain the risks and how useful they were to us in solving a lot of problems ( as well as saving lives! ), they usually changed their position.
Some years ago there was a bit of fuss about photography, with private security often displaying their ignorance of the law and some police not much better. As I do some amateur urban photography I took to carryjng around a bit of paper stating the legal position – nowadays I do the same with the Law or Fiction guide to mask exemption.
Insecurity takes many forms.
Rather dodgy if you ask me. Makes you wonder what they’re trying to hide.
Some useful stats from a comment to the Comment Central article:
A very quick search (gov.uk and statista) reveals that there were recently 3.37 million people over 80 in the UK.
If we take it that nearly all the ~40k deaths were in this age range then it would mean that the vast majority of our old folk are surviving and will survive this virus – only 1 in 80 may die.
The media and the gov. seem intent on telling them and us that they will all die – Nonsense.
If those over 70 are included (5.65 million + 3.37 million = ~9 million) then the proportion (1 in >200) who die is even tinier.
Then if we put this in the perspective of how many die every year in the UK normally ~650 thousand – most of whom are in these age ranges – and would have a high likelihood of dying any way – often from flu and/or pneumonia, then we see how unbalanced the gov., the SAGE (was ever a name less deserved?) and the media.
This should be related to the deaths of the yet-to-be-born (207,000 in 2019). The statistics for death in the UK never includes this number!
Every graphical presentation should show the deaths attributed to the virus alongwith total death rates and those from heart, cancer, dementia, other respiratory, AND pre-born deaths. Otherwise there is no proper perspective.
https://www.statista.com/st…
https://www.ons.gov.uk/peop…
Local rag Live reports
“Gutted Edinburgh eatery Scran forced to close after being told they are ‘not a cafe’
“Scran have shared their devastation after an Environmental Health officer ‘demanded they close while customers were still dining'”
“Initially, cafes with a license [no legal definition] were told they would also have to close, however the next day Nicola Sturgeon confirmed they would be allowed to open as long as alcohol was not sold.
“Speaking to Edinburgh Live, a staff member from Scran explained that after this news, they had “double checked everything” and continued to welcome in customers under the new opening hours.
“”She [Enviro Officer] wouldn’t leave until our customers left and we closed the shop.
“The officer then went on to not caring about a word we said and ended up walking away before we even got a chance to get her details.”
“Edinburgh locals quickly came to Scran’s defense, with one customer commenting: “You are literally the definition of a cafe”.
“Another replied “what a joke man, you could not be more of a cafe”.”
Why can’t these people just tell the ‘officer’ to fuck off? I just don’t get it; it is a choice between going out of business or not.
Labour from the word go have always wanted harder lockdowns so Starmer calling for a national lockdown shouldn’t surprise us.
What surprises me is that it’s clear that Labour have not learned anything from their crushing defeat last year. By advocating another lockdown, they’re complicit in the economic Armageddon that’s coming.
More than anything this should prove to everyone once and for all that Labour hate this country and would want nothing more than the Carthaginian destruction of the UK – politically, economically, socially.
Traitors the lot of them!
Yes – Carthagian indeed. If SAGE recommended salting of our fields to control Covid, Starmer, Hancock and the rest would back it.
Exactly. They’re being led by junk science and are too thick to realise it.
And it most certainly will not win back the lost ‘Red Wall’ so eagerly written about in the MSM.After all, it’s the Red Wall areas which are already experiencing the most hardship.
Starmer has always struck me as a typical slippery opportunist, ever ready to issue ambiguous sound bites, take the knee, and waffle unconvincingly about, for example, the persecution of Darren Grimes, while advocating yet another closure of UK plc.
He’s another Blair type figure: all shine and no substance.
His dismissal of the mounting evidence about the rape gangs in Yorkshire, Shropshire,Lancashire and Oxfordshire while DPP should not be forgotten.
These overpaid apparatchiks are a national disgrace; we can only hope that more MPs will dig deep to find some moral courage and join the 42 rebels.
I’m utterly disgusted.
He kneels before extremism: XR, BLM, Islamofascists and the Far Left – now the extreme wing of the Lockdown Lunatics. The man is a walking appeasement machine.
He is indeed – he embodies weakness, even in the way he holds himself. I hate BoJo and think he is clown, I hate the Tories and think they have betrayed us all. But I can’t even be bother to hate Starmer – he’s a non-entity, he’s not even relevant, he’s not worth wasting hate on.
Yes he’s slimy. The kneeling was what did it for me.
Agree. The Red Wall have seen through him and his lot, I seriously doubt they will ever forgive and forget Labour’s betrayal of the working class especially from the 1990s, their toadying up to the EU and allowing freedom of movement to decimate communities.
Starmer is pure Metropolitan elite and only sees the world through that narrow prism. Anything outside the Westminster and Islington bubble doesn’t interest him.
Pure belief in Lysenkoism
Indeed. This lot are not only economically illiterate but also historically and scientific.
In other words, not fit for public office.
“Traitors the lot of them!”
Starmer and the PLP are pathetic – but I think that the Tories are actually the leaders in the traitor stakes, and are certainly the lead agent in the ‘destruction of the UK.’ And have been for a while.
The entire political establishment in my eyes are traitors. Doesn’t matter what party they are.
Quite agree; they’re all awful, with a very few exceptions.
I think Labour is finished as a political force. The future struggle will be between the moderate and right (if that term means anything anymore) Conservatives, who may end up splitting into two parties when the death of any alternative opposition is confirmed.
I think this is true. What we are witnessing is the last cries of Labour as a significant force, especially in their ability to provide a credible counter narrative to the government. As an opposition should.
They’ve no choice but to take the poisoned challenge of harsh lockdown zealousy because they can’t go back. They’ve presented nothing of merit throughout this mess and continue to do so. To try and now maybe look at the data, question the narrative in a meticulous way would be impossible for them. The turning circle just couldn’t handle a vehicle of that size.
I think so as well. Labour have lost their raison d’etre a long time ago, they’ve become a part of the upper middle class elite and are basically reduced to fighting irrelevant battles and are even more out of touch than the aristocracy of the past.
Hence why I think they’re desperate to cling on to their current client voter base because they know they’re finished.
And the Brexit Party standing in the wings. Apparently standing in the local elections.
No masks in my courtroom!
Yesterday, someone I know appeared in court on a minor traffic offence. It should never have reached this stage but it did. At the start of proceedings the Judge firmly instructed all present in the courtroom to remove their masks with the words ‘I won’t have masks in my courtroom—-remove them!
I find this encouraging. Not only because he probably thinks that mask wearing is a load of boloney and is being used as a tool of social control (I say this because if he had bought into the Covid nonsense, and been brain washed as a result, he most certainly would have insisted on masks—-the example of the funeral director of last week sticks in my craw!).
The other reason of course is that a courtroom, of all places, is a place where truth and lies crash together head on. There can be no doubt that the face is a reflection of our inner selves and that judges and the like rely on ‘facial language’ as part of their armoury when trying to decide innocence and guilt. I can’t imagine how any judge could preside over a room full of masked bandits, not least with the suppression of clear and audible speech that this would entail.
So full marks to the judge. On this ‘evidence’ it would appear that courtrooms at least, are a beacon of sanity.
Was that magistrates or crown court? If the latter it could set a precedent.
It was a minor offence (no one was hurt) and one that should have been settled between insurance companies. I have this information first hand, from the source, and they referred to the ‘Judge’. Other than that I cannot say.
usually matters of motor insurance liability will be dealt with at County Court
These are the courts covid guidance instructions
They specifically refer to a requirement to wear masks . Hence people will have been wearing them but i guess a judge can do what he wants in his courtroom
So they could just lean over the bench and shoot someone then. They don’t have to follow any statue laws at all.
Two excellent articles today on masks.
https://thefederalist.com/2020/10/12/cdc-study-finds-overwhelming-majority-of-people-getting-coronavirus-wore-masks/
https://www.sott.net/article/442455-German-Neurologist-Warns-Against-Wearing-Facemasks-Oxygen-Deprivation-Causes-Permanent-Neurological-Damage
The first one is interesting. Not a great advert for masks, but it’s another reason for the “it doesn’t stop you catching it, it stops you passing it on” thing. You can prove whether someone who catches it wore a mask; you can’t prove that they caught it from someone who was also masked.
You can’t prove that at all anyway, though I also expect that kins of comeback. Taking it back to the famous hamster study then, does that mean they conducted it on the basis of the masked hamsters had SARS-CoV-2 infections, while the umaksed did not. And the masks prevented them getting it?
Such a 2020 sentence that.
The “masked hamster” study was nothing of the sort. They didn’t mask the hamsters, they strung up mask material between the hamsters’ cages. It was in effect yet another mechanistic engineering study that proved only that a hamster’s breath is unlikely to be strong enough to make it through a piece of cloth that’s some distance away from the hamster.
Yeah. I know that actually. I call it the hamsters in masks study out of contempt.
https://fightcovid19.hku.hk/hku-hamster-research-shows-masks-effective-in-preventing-covid-19-transmission/
Exactly. They’ll just say they only caught it because someone else wasn’t wearing a mask.
Have you thought about reporting this to the police?
If anyone dies due to Covid 19 because of the irresponsible actions of this judge, technically, the judge will be guilty of manslaughter.
I imagine the judge might fancy his chances of getting off….
Edinburgh coronavirus experts disagree as one claims herd immunity ‘critical’ to defeating pandemic
Prof Mark Woolhouse disputed claims by health secretary Matt Hancock who said herd immunity was a “flawed goal”
https://www.edinburghlive.co.uk/news/edinburgh-news/mark-woolhouse-devi-sridhar-herd-19100951
Prof Woolhouse told the PA news agency: “Going forward, we would expect more people to be exposed at some stage or another and that immunity would be important, whether natural or through a vaccine.
“Herd immunity is the way this thing ends, one way or another, it is critical to what happens to Covid-19 in the long term.
And yes that is one viscious slimy disgusting propaganda piece from Edinburgh live. Wretched. See those eyes of Sridhar in the accompanying picture. Human warmth, intelligence or something else?
Don’t forget BBC local democracy reporters are on the staff of EL.
We are having a lot of flannel about herd immunity from Tedros and government ministers. Of course, most viruses circulate without the WHO calling on them to be eliminated. If they declare war on them the results may not straightforward. For instance, the attempt to eliminate measles and mumps means that people over 55 or so retain immunity (old fashioned herd immunity) because they had the diseases as children but the effects of the vaccines wear off so young adults and middle aged people mostly won’t have it any more. There must be a considerable concern that we have a large population that does not have herd immunity particularly with measles and that we could get dangerous mutations which could make Covid look like a picnic. If this was to happen it will be blamed on “antivaxxers” but it will be the direct result of six decades of vaccine policy:
https://www.bmj.com/content/367/bmj.l6926/rr-1
On balance good that Starmer has gone full on Himmler. Ultimately will help us extricate ourselves from this mess.
Please explain because I just see it as closing Parliament as an avenue to end this
Politicians are the problem, not the solution – as things stand right now.
Short of a revolution then how can you change things
A Revolution is the only way forward, nothing else is working!
Because any increase in positive cases and deaths will be seen as a victory for Starmer and a failure by Johnson. The government is now incentivised to reverse project fear, minimise positive cases and consequently covid deaths. The intention since March has been to manufacture a scenario in which the government can claim credit for “beating” the virus, Starmer’s intervention makes the accomplishment of that “victory” all the more urgent.
I’m not sure, won’t the left and the press and eventually the public just agitate for it more and more until government “give in”? Especially as cases and deaths will inevitably continue to rise over the winter.
I’ve got a solution to fuel poverty for pensioners.
If we lock them up for 6 months, it will be warm again. Problem solved!
Please sign and share.
http://chng.it/g688Sf7wqN
Scare story of the day in case it hasn’t already been posted:
https://www.bbc.co.uk/news/health-54526660
It seems everything is down to Covid. No other illness exists. I think they are trying to drive us mental, the thing is its working!
I think they are trying to drive us insane. They might actually be insane themselves. We might be witnessing the birth of the ‘cult of the insane’. If this is a plan then the people behind it must be insane, for only the insane would come up with a plan to systematically terrorise the entire planet into obedience in the face of a threat that does not really exist.
The story itself says it is the first case of its kind, and that it happens (rarely) with flu too.
For the BBC to publish this kind of thing, given where we are, given that they are a public service broadcaster, and don’t have to sell ads through clicks, is beneath contempt and a clear indication they are following a line
Having worked as a journalist and editor at the BBC during two other ‘pandemics’ I will give them credit that they aren’t following a line other than that imposed by higher editorial staff for a few reasons:
1) The BBC doesn’t need paid clicks, but the mentality is the same (I was specifically told by our senior editor that our priority was audience numbers, not responsible journalism when disputing our coverage)
2) The editorial staff almost all have the same background and politics, and it is very establishment and very contemptuous of anything that smacks of populism, and they think scepticism is populism – largely because they equate it with Trump.
3) Since the trouble they got into with David Kelly (largely caused by one journalists arrogant lack of procedure) they have been terrified of anything approaching investigative reporting of government policy. When I was there, there was actually a serious high-level discussion about doing no investigative reporting ever again. That was shot down, thankfully, but the fear is real. They are terrified of getting it wrong and giving the government a chance to go in for the kill. The irony of course being that they have abandoned their post when most needed, and now I am sure that many people like me who were once passionate supporters of public service broadcast would gladly see the whole rotten enterprise torn down and buried for ever. I cancelled my licence over their cowardice on this and I suggest everyone here does the same.
I loved my time working there, but it is not what it was and it’s time for it to die.
Exactly and on my own anecdotal evidence, a few years ago now I had really nasty cold that turned into a really nasty sinus infection that caused the cranial nerve in the right side of my face to become inflamed/trapped. Result: Bell’s Palsey. I thought I was having a stroke. Anyway, antibiotics and corticosteroids cleared it up in a few weeks and everything back to normal.
“Doctors could find no explanations for his hearing problem, other than his recent Covid-19 illness.”
So existing asthmatic who was intubated, and needed a blood transfusion, and who conveniently had a covid test on admission that fortunately showed a positive .. so we can blame everything on covid.
Starmer trying to outdo Bozo for idiot of the year!
Sturgeon still holding pole position for now, but a late charge on the outside from the NI government can’t be ignored.
The race to out-stupid each other is never ending
Serious calls for Sturgeon to resign coming thick and fast over a matter of lying to parliament. Ministerial code prescribes resignation in such circumstances.
Essentially the idiot of the year podium might be ‘lance armstronged’.
Nadine Dorries is a contender for the densest government minister award – and she has some very still competition:
“If herd immunity existed, measles and chicken pox would have been wiped out years ago. There is no such thing as herd immunity.”
Doh!
Jimmy Wales (American founder of wikipedia) commented :
If anyone wonders what has gone wrong in the UK, a good starting point would be scientific illiteracy in government.
He’s not wrong.
Ivor Cummins (the fat emperor) was more direct :
“The most moronic utterance this week – and there’s been stiff competition.”
Dorries still hasn’t taken her comment down. Breathtaking conceit and arrogance.
She needs stringing up. She’s strong contender for the Diane Abbott Award in Stupidity here.
I’m not a fan but, be fair, Diane Abbott is not actively abetting the destruction of the country and increasing sickness and death by putting out dangerous lies. MW
Oh dear, obviously heresy on here.
MW
No, she is one of those genuinely, truly, honestly and totally incompetent and following her true nature.
We have a very low bar setting for our political class that’s why they don’t choose the private sector!
I hate having this pillock as my MP. I’ve never voted for her, but even if I did, I’d still want her to be strung up like the rest of them.
Standards are very low and her comment betrays the over all stupidity of our political class.
Dorries should know better: She originally trained as a nurse!
https://www.google.com/search?q=the+stupid+it+burns
Labour supporting this just demonstrates how corrupted both our parties are. This is a Globalist cause and the parties must toe the line.
Do you want Johnson and his government to avoid jail?
JOHNSON AND HIS GOVERNMENT ARE LEGALLY (AND IN FACT) RUNNING (RUINING) THIS COUNTRY. NO-ONE ELSE.
They are 100% responsible.
True but it doesn’t negate the fact that they are following a blueprint
I’d happily lock them up and throw away the keys. I find it equally as deplorable though that we do not have an opposition.
Here is the latest National Records for Scotland report, next one due in November -they are switching from weekly to monthly because you know why.
https://www.nrscotland.gov.uk/statistics-and-data/statistics/statistics-by-theme/vital-events/general-publications/weekly-and-monthly-data-on-births-and-deaths/deaths-involving-coronavirus-covid-19-in-scotland
Key Findings
As at 11th October, there have been a total of 4,301 deaths registered in Scotland where the novel coronavirus (COVID-19) was mentioned on the death certificate.
The first mention of COVID-19 in a registered death certificate was the week beginning 16th March 2020.
Of the total number of deaths registered in week 41 (5th to 11th October), there were 25 where COVID-19 was mentioned on the death certificate, an increase of 5 from the previous week (28th September to 4th October). Deaths involving COVID-19 are at a slightly higher level now than in July and August, but much lower than at the height of the pandemic.
47% of COVID-19 deaths registered to date related to deaths in hospitals. 46% of deaths were in care homes and 7% of deaths were at home or noninstitutional settings.
After adjusting for age, people in the most deprived areas were 2.1 times more likely to die with COVID than those living in the least deprived areas.
Of those who died with COVID-19 between March and September, 92% had at least one pre-existing condition. The most common main pre-existing condition among those who died with COVID-19 was dementia and Alzheimer’s disease (31%), followed by ischaemic heart disease (13%).
Age-standardised death rates (adjusting for the age-structure of the population) were 43% higher for men than for women (168 vs 118 per 100,000 population for deaths occurring in March – September).
If the doctor is getting paid for ever supposed Covid death then we’re all be dying from Covid.
At what point did the government of the United Kingdom decide that we needed them to save us from the perils of life, however remote the risk?
Was there a moment when the public requested this help? Was it the formation of the welfare state, or the creation of the NHS? Did it happen later, perhaps in the wake of 9/11? I’m genuinely interested in people’s thoughts.
I for one do not feel the need for the government to hold my hand through life. I just want them to enforce a reasonable (and small) set of laws to ensure that we can function as a society with killing each other. And nothing else. I want to be served by them, not ruled by them.
I said this to my MP a couple of months ago. Their job may be to warn us of any potential risks but to take it upon themselves to take control of our lives to protect us is way beyond their remit.
I think it’s apparent this has nothing to do with the virus its about controlling us.
I want the government to get the hell out of my life and stay out!
Same with all the virtue signalling, including muzzles. I want no one protecting me.
If someone says to me I’m doing it for you I will reply “well I am specifically asking you not to!”
Great reply. I certainly don’t want anyone protecting me.
Hence why that NHS advert “I wear one to protect you. Please wear yours to protect me” is an abomination and a lie.
Couldn’t agree more. This level of control or responsibility is beyond their remit. But more and more people seem to expect protection from everything. I think it’s all part of the litigation culture and excessive health and safety.
The elites patronise the plebs. We are the unthinking, lumpen, blobs, who need protecting from ourselves and protection from them.
There wasn’t a single moment, it was a long slide towards dependency.
Does anyone have videos or first person reports of what’s going on in care homes or with the elderly?
The whole “it’s worth it to save just one life” thing is winding me up, because it’s an appeal to emotion that’s easily opposed when you’ve got elderly people who are literal prisoners at the moment. I feel like bombarding some of these people with what’s happening.
I’ve recently seen this video of a woman singing to her mother through a closed care home window:
https://www.youtube.com/watch?v=pcPMDkmKnH0&ab_channel=DianeMayhew
The video of a man being told to stop comforting his mother at the funeral of his father:
https://www.youtube.com/watch?v=zhV4oWthRas
This woman whose father is severely declining because he can’t see his family or even his wife who lives in the same care home (this is quite distressing):
https://twitter.com/talkradio/status/1314551428493574150
And this image:
If we could put together a bunch of these I think it could be quite helpful.
Heartbreaking. Can’t help with any personal info, did the rules change to allow visitors into care homes now, its extremely concerning.
Breach of human rights
That interview made me shake with rage. Anyone who supports these policies after listening to that… I don’t even have the words for them.
There’s this one:
https://sgetdotinfo.files.wordpress.com/2020/10/testimony-of-a-carer-during-covid-19.pdf
https://parliamentlive.tv/Event/Index/6fb9ecbd-ab26-49d8-9a9f-dba49b605f05
See also yesterday’s Commons Select Committee, witnesses giving evidence about how carers and their respective mother with dementia, and a mentally handicapped daughter have been coping (or not) with lockdown. Hard to listen to.
It beggars belief (again). This from The Telegraph live feed:
Time circuit breaker with Christmas holidays, advisers say
Prof Medley added that any circuit-breaker should ideally be timed with school holidays to minimise disruption to education.
“So, half-term or potentially over Christmas,” he said. “You could even potentially add a week to the Christmas school holidays and potentially get some kind of three-week break, but the whole point is to reduce the prevalence before you actually have to do it.
“The reason that the lockdown (in March) worked, is because it separated households. “And that’s essentially what we’ve got to do is to make sure that the transmission doesn’t go from household to household, and two weeks is the minimum time.”
Prof Medley said thousands of deaths could be prevented up to January with a circuit-breaker but it was accurate to say that did not necessarily translate into lives saved in the long term.
The modelling paper written by Prof Medley and colleagues sets out that deaths could possibly reduce for the rest of the year from about 19,900 to 12,100. Hospital admissions could be reduced from 132,400 to 66,500.
A limited lockdown, with schools and shops open but hospitality venues closed, could potentially cut deaths to about 15,600, they said.
Prof Medley said lives would undoubtedly be saved through the NHS not becoming overloaded and by the health service being able to continue with other routine care, such as cancer treatments.
He agreed that several short circuit-breaks until a vaccine or better treatments arrived could also save lives in the long run.
“If you know there’s a vaccine coming and treatments are going to get better, which they probably are, then yes it will save lives,” he said.
Consider the last-but-one paragraph. So there you have it. Lockdowns ad-infinitum if this chump gets his way.
Yay, three weeks at home with the kids in the middle of winter with nothing for them to do?! Where do I sign up…?
This is problem.
Someone can just say that lockdown worked, when all the evidence shows the opposite, it gets put on a national paper, and the idea becomes more entrenched.
It really is the case that a lie repeated a thousand times eventually just becomes an accepted truth.
Welcome to the Covid Hoax
How do we know that cases went down in March due to lockdown rather than some other factor? The weather, or the effect of sunlight vitamin D levels, or some other factor? The causation that is assumed because of the correlation between lockdown and covid deaths seems like a statistics 101 mistake.
What is insidious is the use of a specific number like 15,600 to imply accuracy when in fact it is just guesswork at best (albeit with some mathematical calculations underneath). Of course they get around accountability with the use of the word “potentially” but they are well aware that it is likely to be interpreted as fact. It is disingenuous, bad science and downright dangerous.
Prof Meddlesome
I have just read the Medrxiv preprint and as I rather suspected, the model says nothing about saving lives in the long run. All that happens is that the “circuit break” postpones infections and deaths. Indeed, the model assumes that after the break, they continue to rise again at exactly the same level as before. This is nothing but “flattening the curve” as we had it the first time round. To say that the mode predicts saving any number of lives at all by January, or any other fixed date, is correct but irrelevant, unless you believe that something is going to happen on that future date that will change the dynamics of the infection.
More excellent comment from Sunetra Gupta on Great Barrington Declaration.
https://unherd.com/2020/10/matt-hancock-is-wrong-about-herd-immunity/?tl_inbound=1&tl_groups%5B0%5D=18743&tl_period_type=3
Great rebuttal by a true scientist at the top of her game. Unlike the thick corrupt totalitarian liar like Hancock. How dare he stand there and tell complete lies and half truths. Just what are his medical qualifications? Is he just making this shit up himself or is somebody spoon feeding him this bollocks?. Well, he can get away with it as most of the MPs are as thick as he is and will never try and find out the truth..
I’m not coming back to this comment, but I have a question for those (and there seem to be many here) who keep insisting that the situation in the UK is not the fault of British politicians, but that they are instead obeying the orders of shadowy globalists (presumably Gates and Soros, etc)
What is is that you think these people have on the government? Why would they be following someone else’s orders?
Does Gates have a pee-pee tape on Johnson? (As the Democrats alleged – with no evidence – that Putin had on Trump in the US?)
Why should Johnson follow the orders of “globalists”?
Johnson and the other British politicians are 100% responsible for this disaster. No one else. I am not a fan of Gates. I do not want forced vaccines. But he is not running the UK!
Gates has money. He may be able to buy influence. But he does not have an army at his command. If Johnson wanted to invade or bomb a country he could do so. Gates couldn’t.
If you think Gates and his ilk are running the show, then I’m sorry, but I think you are unhinged.
Please give it a rest. Everyone is well aware you don’t believe it’s a global situation, you don’t need to keep reiterating it day after day, post after post.
You’re probably wasting your time asking! Regarding politicians, stupid does as stupid does
A promise of untold riches!
The Fourth Industrial Revolution’
The 2017 Matt Handcock speech you didn’t know about. On the UKGov website.
https://www.gov.uk/government/speeches/the-4th-industrial-revolution
“…And I’m delighted to speak alongside so many impressive colleagues who really understand this, and alongside Professor Klaus Schwab who literally ‘wrote the book’ on the 4th Industrial Revolution. Your work, bringing together as you do all the best minds on the planet, has informed what we are doing, and I’m delighted to work with you. …”
What do you think of that?
“What do you think of that?”
Brave Sir Robin has already said that he’s running away.
I think there are different variations of us lockdown sceptics and what we believe. I am unsure about the whole Gates and vaccine thing but be have to unite as lockdown sceptics no matter what and respect one another.
Me neither but it is all so surreal I can’t count anything out these days. The most surreal thing was Bozo talking about windmills – whoever would have thought that!!!!
Lol, seriously look. It’s not just Gates but he is a huge player, it’s not just the rockefella foundation, it’s not just the UN. it’s not just the WEF, it’s not just big pharma, it’s not just big tech , it’s not just almost every other country in the world doing the same covid meltdown
Do you see?
Yer its all about Boris and the cabinet and the rest of the UK government.
Where you are wrong, is that he does have an army at his command. It’s just a very different type of army than the one you are used to. It’s not soldiers in uniforms. It’s scientists in lab coats, academics in positions of “authority” and the leaders of groups such as the WEF and the WHO, while also having the ability to pop up on television for interviews and to spout his nonsensical views, seemingly whenever he desires.
Just look at the flow of money.
Our own Dim Witty through LSHTM received a grant of £31m.
He’s funded the WHO over $1.5bn.
He’s funded GAVI over $3.1bn.
Klaus Schwab has boasted of being on first name terms with Bill Gates and he’s been a constant staple of the WEF for years.
Why Bill Gates is even given any notice at all is solely down to money – he has absolutely no qualifications whatsoever – NONE. Let alone any medical, biological, scientific or epidemiological qualifications.
So your argument can be boiled down to this: Those who command armies and can “bomb a country” have more power than those who don’t. And those with weaker or no armies cannot really influence and manipulate those with bigger armies.
Religions have had huge influence without standing armies – or very limited ones.
The idea that influence is only achieved through brute force is rather simplistic and infantile.
Doesn’t mean that Gates is running the show. But he could still have an enormous amount of influence without commanding a standing army. And in fact clearly does.
Nick Clegg.
You’re right Johnson, the government and their advisers are to blame .Everything else is just letting them off the hook .There’s no hidden hand stopping him changing course tonight .But he won’t because he’s a cowardly ignorant fool and will know his time in power will come to an end .
The intellectual scepticism about ‘herd immunity’ is justified, and actually shared by a certain Mr. Tegnell.
Equally true is that without various immunities existing, there can’t ever be a vaccine.
Obvious is that lockdowns (and masks) didn’t and don’t work, that they are actually harmful with regard to lumiting infections and illnesses, and a sheer catastrophe, if all their collateral danage was included in
their assessment.
The suggestions of the GBD are therefore absolutely correct, as the Swedish experience shows, but its reasoning is also indeed flawed.
Not that it matters.
They and the sheep are hellbound on taking us down with them.
Indeed. Herd immunity was coined by the vaccine industry to motivate enough people to get a vaccine. Interesting development now that they play down the herd immunity concept. I wonder why?
The good thing is that there is no need for ‘herd’ immunity in Covid. Most of us have already been exposed to SARS viruses and our t cells have memory of them and will fight covid viruses should we get exposed to them. In addition, our immune systems will protect us against the onslaught. The more optimal your immune system the better protected you will be.
Hold on this seems to be a confusion in terms of classification of the term herd immunity.
So we can have immunity, T cells etc. However, it doesn’t mean a threshold can be reached that sees transmission of a virus become simply endemic and low level due to less ability to spread?
No, we don’t have herd immunity to the flu virus (which is actually an ever changing organism). We still get infected, many of us do, anyway. But most of us can cope with the infection.
I think herd immunity implies the absence of infection altogether.
You are unlikely to catch flu twice. A lot of “flu” is often something else.
Not true. Flu mutates so you catch a different strain. It’s an influenza virus. Covid 19 or SARS cov 2 is a coronavirus. These tend not to mutate as quickly as influenzas and rhino viruses.
So the fact that someone gets infected with SARS-CoV-2, and, in many cases develops an immune response, does that not lead to increased population immunity? And, the crucial question, would this be better done in the least vulnerable groups rather than locking down economies and destroying them? As the GBD suggests.
The overall goal is to reduce lives lost as a whole. Surely immunity plays a role here? The herd argument is a question. Of how much.
Sure, it can mutate. But does that always happen in one direction, i.e. that the next strain is just as virulent?
What seems rather apparent after seeing governments and health officials around the world flailing around imposing random measures based on half-baked ideas is exactly how little we actually know about microorganisms and their spread in humans.
We haven’t really advanced much in the last 150 years.
If so, they were playing a very long game. The term dates back at least to 1920, when L.P. Beechy published a paper “Abortion Disease in Cattle” in Bulletin of the Ohio State University Agricultural College Extension Service vol.XVI
Don’t know why you have such a fixation on trying to discredit the concept of herd immunity, but it’s not really open to question. It’s more of an evident fact about reality and the way our immune systems interact with pathogens. In most cases, once you’ve had a particular disease you are very unlikely to get it again for a while, and that fact in and of itself makes herd immunity a direct consequence..
You can argue about when and to what extent it applies in particular cases, or you can try to create a definition of it that is unachievable (such as zero infections), in order to use as a “straw man”, but general scepticism about it as a concept is intellectually questionable and of little use at the best of times. At the present time, it’s downright counterpoductive, as simply giving ammunition to the panickers and lockdowners.
Handjob denied herd immunity exists ,can you believe it I mean ffs
A while back there was a movie called The Age of Stupid with the late Pete Postlethwaite.
It was all about a world that hadn’t dealt with the “climate crisis” with a man in 2055 looking back on the world.
It seems the Stupid is already here.
In the Philippines there was a famous senator called Miriam Defensor Santiago. She had some brilliant quotes put in a book called Stupid is Forever and then a sequel called Stupid is Forevermore.
“All professionals in our country need to pass a government exam. Only a politician does not need any kind of preparation to practise”
Another:
“There is no substitute for a reputation.
It is like virginity: once lost, it can never be recovered.”
The next pod will be out SOON! Vaccine madness!
Found on the EU patents Office website from 2015:
https://worldwide.espacenet.com/publicationDetails/biblio?II=0&ND=3&adjacent=true&locale=en_EP&FT=D&date=20200903&CC=US&NR=2020279585A1&KC=A1
“A method is provided for acquiring and transmitting biometric data (e.g., vital signs) of a user, where the data is analyzed to determine whether the user is suffering from a viral infection, such as COVID-19. “
How did they know what something would be called 5 years before it was “discovered”?
Video about it no longer available – what a surprise:
https://www.youtube.com/watch?v=V1N_oKcqhYA
But this non-English one does:
https://www.youtube.com/watch?v=8V32yA9wUvQ
https://silview.media/2020/10/04/atomic-bombshell-rothschilds-patented-covid-19-biometric-tests-in-2015-and-2017/
I am giving this sort of stuff a wide bearth. Those patent records can be edited as time goes by. They maybe had patented a PCR test and added tie CV-19 reference later so it would be more appealing and show up in searches.
Obviously the Rothschikd name is a little errrrrrrrrr controversial
But an almost identical patent in the US in 2017 by the same person?
I agree it doesn’t prove much by itself but the coincidences are mounting up.
I think you are 100% right here. I’ve worked on similar databases. The records have been updated with a new description. Nothing sinister.
Glad someone knows how these things work.
Reading the 2017 article and links it looks like it was written and patented back then and it then sits in the background until the publish date comes along which was September 2020.
It’s a bit like there is a few years where the people who patented it can make some money, tweaks etc before it becomes public and others can make similar systems.
The filing date of the “Covid” patent is 03 Sept 2020. It claims a “priority date” of 13-Octo-2015 by reference of a related patent. To quote an EPO source
In this case, it seems that the 2015 patent “System and method for using processing and displaying biometric data” was the invention and the 2020 patent claims its applicability to Covid.
I put this as a comment on our “local” newspaper website (Leicester Mercury) and it has been marked awaiting moderation now disabled!
“Content disabled again LM why??
RT-PCR positive or with symptoms?
These are the questions you should be asking using FOI, these are the important numbers.
How many patients are there in Glenfield/LRI with definite diagnoses of Covid19 excluding patients who have tested postitive for SARS-COV-2 virus but are ill from from the virus covering the period 4th July 2020 to 14th October 2020 stratified into weeks and also by age?
How many people have died with a definite diagnosis of covid19 excluding people who have just tested positive for the virus?”
This is after the following comment was disabled
More fearmongering from the local press. These are RT-PCR test results not genuine cases.
These are the questions you should be asking, not simply parroting numbers from another website.
Use the FOI to ask the questions
How many patients are there in Glenfield/LRI with definite diagnoses of Covid19 excluding patients who have tested postitive for SARS-COV-2 virus but are ill from from the virus covering the period 4th July 2020 to 14th October 2020 stratified into weeks and also by age?
How many people have died with a definite diagnosis of covid19 excluding people who have just tested positive for the virus?
But that would be like, journalism…
The worst thing about this is that a second lockdown has been planned since the first. They knew prevalance would increase in the autumn, as all colds do, and with mass dodgy testing they could generate the numbers required. Actual context dosen’t matter when the sheep just keep swallowing scary MSM headlines and soundbites. After some inconvenient pushback over the past month, Smarmer is now playing tag-team to get it over the line. Meanwhile, the big players are confident enough in the smokescreen to openly reveal their true objectives.
Then they are going to be disappointed. The tide has turned.
Is it? Round here, I just see an obedient flock of sheep.
I think that’s still the case ‘on the ground’. But when you get popular TV presenters like Richard Madeley speaking out against the regulations, I think it means that things are starting to change.
They knew then the dates of the US elections. I was unconvinced, when I read somewhere back in March, that a lot of this panic was related to bringing down Trump. As we get nearer the date however, I’m now convinced this is part full blown culture war/part complete fuck up.
Boris actually said in the summer, he hoped things would improve after November.
Question is, what happens next?
The US vote is the ultimate litmus test, they need them on board to pull their plans off. Trump winning again will will be a massive blow, hence the increasingly desperate attacks.
You might enjoy listening to this lot:
https://www.youtube.com/user/X22Report/videos
Not sure how legit or sane he is and cannot vouch for his credentials or anything else but some of what he says gives me hope even if it is false hope.
Yep. They’ve been talking about a second wave since March, so it was obvious they were going to manufacture one.
I was unsure how they’d play it in regards to numbers – my assumption was they’d just lump in flu cases with corona, put that number as the big headline, and then only differentiate at the very end of the article, but it turns out that the test is so unreliable, it’ll just pick up flu as covid anyway!
As well as dog hair and a pavement.
Maybe a bit off topic but why socially distance cars?
https://nypost.com/2020/10/12/biden-speaks-to-30-cars-of-supporters-at-ohio-drive-in-rally/
Can cars catch covid-19?
Can covid-19 travel through metal and windows to infect passengers?
Hell of a virus if it can do that.
But if he is supposedly going o win the US election then I would have thought more than 30 would have trend up.
On no-one at this rally:
https://www.waynedupree.com/2020/10/biden-harris-az-campaign-event-empty/
or were they all socially distancing as well?
Can cars catch covid-19?
Yes.
You may laugh but my car caught covid-19. It stopped working, wouldn’t move from the driveway and started demanding that all other cars stay home too.
Coughed & spluttered a bit before starting, too?
My car has never had any taste.
My dog’s got no nose…
The government has made it illegal to examine a car engine to find out what is (really) wrong ith it.
Bit worried – Think my car may have Covid but is asymptomatic
Perhaps it’s just a bit hungover.
My car’s always suffered from long covid
My step daughters school have banned cars dropping kids off in the car park, because …. covid.
Wha??
In September, my council was saying drop pupils off by car if possible.
In October, they were saying actually don’t because of severe congestion around schools.
Social distancing concerns have repeatedly been used to pull the plug on various drive-in events. In truth I suspect ticket sales for the events have been non existant and so the projects pulled.
Let’s face it, Covid has been used a charter for jobsworths and life-haters.
I have taken my car into the dealers this morning for its service. You couldn’t go into the office but had to be met outside for the hand over, you can however go into the office (muzzled of course) to pick up the keys when it is done. Another example of the ludicrous rules where Covid is concerned, it knows when a car is being brought in or picked up!. My husband will go in to pick up the keys, as I won’t wear a mask and can’t bring myself to be civil. I wouldn’t have used them if it hadn’t been for the fact that the service was part of the deal when I bought the car.
Ya may be a noisemaker, spirit maker
Heartbreaker, backbreaker
Leave no stone unturned
May be an actor in a plot
That might be all that you got
’Til your error you clearly learn …
Now, there’s a woman on my block
She just sit there as the night grows still
She say who gonna take away his license to kill?
As i have been saying for a while now, just because the Tories have done an absolutely disastrous job handling this pandemic, it doesn’t mean Labour is any better!
Though Corbyn voted against the government last night, defying his party who were told to abstain. Strange times!!!!
I wasn’t and am not keen on J Corbyn for many reasons, and clearly Labour for various reasons are quite pro-lockdown, but I am beginning to think we may have been better off with Corbyn as PM. I think he has more spine than the PM.
Absolutely not. Corbyn is and has all along been a full on panicker, referring to herd immunity as “eugenics” (the sure sign of a true knob).
Jeremy Corbyn: government lectured me about herd immunity
As did Diane Abbott, to be fair to her.
The only Corbyn I’d vote for is Piers.
I don’t find it odd. He’s just one of the few MPs who actually votes the way he believes.
Everyone on here decrying the MSM should take a moment to actually look at JC and consider whether their antipathy towards him is not just what the media MSM wanted you to think.
For starters, he couldn’t have been more obviously a Euro Skeptic without defecting to UKIP.
Please would you stop using “cases” when you actually mean “positive test results”? If I want to know about “cases” I can just look at the Guardian or in fact any other MSM! Thank you!
How does a 4th industrial revolution correlate to what is going on now? Can only think the controls are to stop riots when people realise that their jobs will go forever and a basic rate to live on is what’s on offer.
They were talking about the 4th industrial revolution long before anybody had heard of covid
Yes, so moved on to how to do it, presumably. Talking about climate change too before Covid, and how to solve it.
Global warming has been about since at least 1994 Rio Earth Summit (?). Global cooling in the 1970s was scientifically ‘proven’. I forget what we were doing in the 1980s, what it a litter pick?
Yes, the company I work for are involved with it.
We’ve been talking about it since 2015/16 from memory.
https://www.cidob.org/en/publications/publication_series/notes_internacionals/n1_183/wise_cities_the_universal_basic_income_facing_the_challenges_of_inequality_the_4th_industrial_revolution_and_the_new_socioeconomic_paradigm
4th industrial revolution is just a term used to cover further progression towards distributed systems requiring less and less human intervention. We’ve been on this course for some time, obviously, however various technologies (AI, IOT, AR, VR) are converging to accelerate the process.
I’ve been of the thinking for a while that we’re moving towards Universal Basic Income controlled by social credit systems. Enough politicians and think tanks have been talking about this over the past five or six years it shouldn’t be too controversial.
As far as current events are concerned, I think many technocrats view this as an opportunity to act as a catalyst or accelerant.
Maybe this is where the Singularity begins?
https://en.wikipedia.org/wiki/Technological_singularity
Well, my office just sent around the following survey. Notice how it segues from Covid into environmental issues, and none of the options are “no thanks, it’s a load of bollocks”. The goal presumably being to get this Green Wave outfit a justification for lobbying the company for various changes (presumably, filtered though the globalists’ agenda).
https://www.surveymonkey.co.uk/r/GWSurvey01
Looks like Green Wave is a political lobby group for Biden in the US:
https://thehill.com/policy/energy-environment/519272-green-groups-launch-green-wave-2020-initiative-to-boost-competitive
Here they are, got an award for
https://www.greenwave.org/
The leader of the opposition: (Sir) Iain Duncan Smith, Tory MP for Chingford and Wood Green talking to Julia Hartley-Brewer on Talk Radio:
https://twitter.com/MPIainDS/status/1316288595590885376
“This is not a circuit breaker. This is a business breaker.” Former Conservative Party leader Sir Iain Duncan Smith says Keir Starmer’s circuit breaker lockdown is “naked political posturing.”
Damn right.
Christ – what world do we live in when Iain Duncan Smith is the clearest head in the room. In an age of giant problems, we are being led by intellectual pygmies. Has there ever been a lower-grade bunch of dribbling morons in a position of power than in the world right now. It’s Generation Fuckwit
He was one of the least effective Tory leaders, but that was more down to a lack of leadership ability – his views on most things have been fairly sound.
Now let me get this right; if you have a drink in a pub, the virus will get you but if you have a “substantial” meal with that drink, it won’t.
I’m going to lie down now for a while.
It cant get you if you buy alcohol in an off licence or supermarket before 8pm, but if you dare buy alcohol after that time, Covid can get you!
They are fine as long as you both wear a mask. Off to the gimp shop…
Apart from Bojo.
I can’t believe our supposed Libertarian PM is legislating on how hearty my supper has to be! What if I just want an omelette? Soup? Sometimes I just feel like Rice Krispies
You can get a circuit breaker on Amazon for £4.29. Am I missing something?
I wish someone would open Matt Hancock’s circuit breaker…
That’ll be a cheap one shipping from China.
Isn’t it amazing that every member of the “general public” when interviewed either say that they agree with the latest lockdown measures or say that they should be more severe; strange that, ain’t it.
It has become unsafe to air one’s views unredacted. But, you must understand, there is no conspiracy.
A good old saying goes:”Never believe anything that you are told and only half of that what you see”
https://www.youtube.com/watch?v=GeykREAlYSg
Sky news Australia has woken up
They’ve been sceptical for months. Breath of fresh air compared to the UK joke of a media.
A quite astonishing statement! A bit like the head of the IMF saying “wealth is created by printing money not through useful economic activity”.
I can believe the head of the IMF would say that. Welcome to the end of the Age of Reason.
HA! Great comment bro.
Herd immunity, or general immunity is like progressive overload but for the immune system.
You adapt and get stronger depending on exposure.
Most of Nature follows this pattern until the continued exposure at higher and higher levels results in diminshed returns.
Stupidity on the otherhand gets stronger the more you do it
I had to read the statement by him twice! It does not bode well.
Another way to try and wriggle out of the coming Class Action Law suit by Dr. Reiner Füllmich / ACU.
Germany’s Extra-Parliamentary Corona Investigative Commission Launching a Class Action Suit Against Corona Criminals
https://www.globalresearch.ca/germany-extra-parliamentary-corona-investigative-commission-launching-class-action-suit-against-corona-criminals/5725633
.Another way to try and wriggle out of the coming Class Action Law suit by Dr. Reiner Füllmich / ACU.
.Germany’s Extra-Parliamentary Corona Investigative Commission Launching a Class Action Suit Against Corona Criminals
https://www.globalresearch.ca/germany-extra-parliamentary-corona-investigative-commission-launching-class-action-suit-against-corona-criminals/5725633
Here’s a fascinating look at the historical (and geological underpinnings of the N/S Divide that are so evident at the moment.
https://unherd.com/2020/10/england-has-always-been-two-nations/?tl_inbound=1&tl_groups%5B0%5D=18743&tl_period_type=3
I agree, I reckon they are still falsifying death certificates.
Combining flu and covid reporting and switching reporting to monthly instead of weekly seems to be curious. Less granular data, to use their phrase. Why that.
Forget the circuit breaker, what we want is a Bypass valve to divert us back to sanity.
Wow… just wow…
https://www.dailymail.co.uk/news/article-8838763/Council-hands-USED-Covid-testing-swab-kits-mistake-students.html
Well, “BUY ONE, GET ONE FREE”
Gotta keep those infection rates up. We’re after top tier payouts.
Bet that’s the tip of the iceberg
They’d be all fine if it was mine they’d reused.
It’s interesting that Prof Bhattacharya says that “…contact tracing may make an outbreak worse.”
I read the article, but I couldn’t see where that was explained further. Unless he meant that people just aren’t telling contract tracers anything. But then, how would that make an outbreak worse? It would just be a case of it is what it is. Can anyone explain?
And while I’m in questioning mode, is there any country other than Sweden where the national response is being led by non-politicians?
I agree with you. The only thing I can think of is that it causes risk compensation by people assuming there is a system in place that works.
I do think that is a genuine argument (one of many) against masks, but I’m less conviced where T&T is concerned.
Possibly because it is pointless to quarantine healthy people? And may also make things worse as you’re stuck indoors with others 24/7? In some households people don’t actually see each very often!
Do these cunts do anything but virtue signal. A part from a few university loons no one cares about diversity.
I always thought it was the median age at 82? Not that it makes much difference.
I think the median and average are very similar. I did look it up once but can’t remember the figures.
Temporary mortuary to be set up in Nottinghamshire
https://www.bbc.co.uk/news/live/uk-england-nottinghamshire-54479215
More fear project propaganda and the masses will lap it up.
They set one up at Teesside Airport during “the wave” – but it wasn’t needed.
We got all this crap at that start. Temporary morgue in Hyde Park, etc.
All scaremongering bollocks!
It states:
In April, Nottinghamshire’s local authorities set up a similar site at an industrial unit in Mansfield during the outbreak, which fortunately was not used and has been “decommissioned”.
Councillor Sally Longford, the deputy leader of the city council, said: “The Mansfield facility… was deemed too large and costly when thankfully it turned out the government projections for death rates had been overly pessimistic.
“It was therefore agreed to set up a smaller facility… in the event of a second wave coinciding with annual winter pressures resulting in excess deaths.”
Well, they are hardly going to need this one are they?
Just visited my daughter whose friend works in a care home. The friend has told my daughter that they have been told to record all deaths as covid deaths to avoid an autopsy/further investigation.
Quelle surprise!
I really don’t understand how people cannot see through it all.
I think they are just not looking. If you only get your news from the BBC and don’t ask questions, they just don’t know this is going on – and probably will struggle to believe it even if you try to tell them.
I’ve got friends, neighbours and family who just watch the BBC News and aren’t inclined to look elsewhere for information. I try to help them understand what’s going on but they just don’t want to know and would rather try to ignore it until it’s gone away. Intelligent people too, but sadly non-inquisitive at best and ignorant at worst.
They aren’t doing autopsies on Covid deaths – by order.
I believe many Muslim deaths are treated similarly.
Assumed that was happening for a while, ever since the system was changed to create this perverse incentive. Good to have confirmation from source.
Mate, which nursing home? We’re doing a bit of a ring around and want to speak to a few NH’s about how this is all going.
Good on you. I hope you get the info into the public domain if you get someone willing to speak out whilst protecting their anonymity of course.
Anyone who is told to commit fraud should not do it, but I can see why so many people would. They can just be pointed to the millions of unemployed people who are totally struggling and be told – this might be you if you disobey orders.
Similar things happened during the holocaust.
Just wondering whether anyone else is considering cancelling media subscriptions based on Covid fear mongering?
Mine is the fT. Used to love that paper, it is excellent on so many fronts but how can I finance the fear it spits out.
Cancelled my tv licence last week. Won’t be renewing the News Yorker’ subscription as it’s massively anti Trump and pro lockdown. (Not a Trump supporter, just want balance!)
Indeed. It is sickening!
Used to buy the the Telegraph on an adhoc basis – no longer.
Used to read DM headlines online – no longer.
Used to listen to Radio 2 in the morning – no longer (Absolute 80s is much better and more fun)
Used to watch BBC once in a while – making a point of not watching any BBC programs
Considering signing up to the Guardian. Pure comedy gold. Could use a chuckle in the mornings.
For something to escape: check out Talking Pictures TV (Freeview 81 where I am): mad old films, mad old tv series, and NO NEWS WHATSOEVER.
Fabulous.
Why on this earth would you like to give your money to the Guardian?
Yes, my Telegraph subscription cancelled. I’ll miss the one or two good opinion pieces from Allison Pearson, Sherelle Jacobs etc but for the most it was just good old scaremongering headlines straight from the Ministry of Truth and I’m not funding that.
I just googled Allison Pearson, and the three first hits with images on the strap line at the top are her own latest tweet (fair enough), but then two tweets from other people calling her breathtakingly stupid and evil because of her attitude towards covid.
Same search in DuckDuckGo just reveals her own articles and one on her being banned from twitter.
Google really has been got at.
Cancelled BBC licence, stopped reading Guardian (appalling news/opinion but best sports section in any paper, will miss it but not them)
I’ve stopped reading two forums completely succumed to the hysteria. One of them even has an arsey muzzealot.
When it all started(before this site even existed) I picked a Private Eye in smith’s to see what they’d make of it. Never again.
I won’t be renewing my Private Eye subscription when it comes round in January. Not just their covid coverage, with a few exceptions it’s become too predictable and unfunny.
Cancelled DT, Cancelled National Trust.
Left church…
BBC
Cancelled TV licence and most club and magazine memberships that bang on continuously about it and the new green utopia and how we must obey.
Cancelled my Times subscription – it was just becoming a propaganda rag. I miss Neil Oliver’s column though.
Have boycotted the MSM for years now.
And also have cancelled my National Gallery membership.
Just had a business meeting on Teams (I’m in the office, everybody else at home as the TFL is NOT SAFE (eye roll). We were talking about this situation and I said a couple of skeptical facts out loud..Somebody then said, listen I know you are not one fo those covid deniers ae you? I know I should kept my mouth shut but I said well a virus that has a 99,98% survalibity rate and where the average age of death is higher than the normal lif expectancy is really not more dangerous than the flu….Tumbleweeds for about 40 seconds…people stopped breathing. I just laughed and continued the meeting like nothing happened.. I had enough, fuck them!
Join the club. I do this every day, and my colleagues hate me for it.
This is gold! We do it all the time in our respective jobs!
I wish I could but I am one of the bosses and feel like I should stay away from discussing controversial topics with staff.
But am familiar from other contexts with the open-mouthed reaction and with the pathetic inability to deal with someone who dissents from a narrative without using the word “denier” or “conspiracy theorist” – anyone who does so immediately goes down in my book as an intellectual pygmy who has already lost the argument.
My team and I have been in the office every single day of this Fakedemic…we are all key workers and I’m the manager. I say these things in very senior meetings because I just have had enough of this bullshit and will not listen to somebody who has basically been hiding in their house since March. I keep getting the ” you must be so brave ” talk all the time”. The reason ? Because I go to the office every day and take public transport? We have now made fear into a virtue and paranoia into a religion. My team know I don’t wear mask and don’t tolerate one in the workplace ( despite the new rules). What they do outside the office is their business. To be fair to them not one of them said they were scared or anything like it even during the height of this in April, May..
Some people have actually said to me and my wife “Oh you are really brave and don’t you feel scared” for going for a cup of coffee.
That post has cheered me today! Good one.
I may have been guilty of regularly speaking similar things during the never ending sequence of Teams/Google Meets/Skype/Zoom calls.
I usually say – ‘its just a cold’ and when I get the reply ‘colds dont kill 45,000 people’ I correct them and say ‘colds kill several hundred thousand per year in the UK – if you counted it in the same way as covid – although I tend to think both colds and covid are just complicating factors in deaths of old age’
You sound like me in the office….massive sceptic surrounded by a lot of people who are far from the worst (or they wouldn’t be here) but look at me like I’m mad when quoting the ONS weekly death rates every Tuesday !
I know how you feel. I must be the only sceptic in my work – every time I cite facts and the dire effects of lockdown, I’m always greeted with the following:
It’s reached the point now where they’re deaf to any reason and logic so I’ve come to the conclusion that only compulsory redundancy would wake them up.
The can never be wrong is a hallmark of pseudoscience.
The leadership across the board have nothing to offer except a dystopian abyss. The “vaccine as the saviour” narrative is falling apart at the seams.
The choice we face is becoming increasingly stark: comply and face up to the end of our civilisation, or rebel. This point needs to be conveyed more and more aggressively to the people around us who are still under the spell.
That’s pretty much the sum of it.
Most terrifying thought for today:
After seeing an earlier comment about the SDP I went to their website to read it.
Ye gods, I may agree with them – truly frightening and strange times if that is the case.
Don’t worry, I found myself agreeing with UKIP yesterday.
https://www.ukip.org/the-results-are-in-authoritarianism-has-failed
The SDP have been sensible on a few policy areas in recent years. They’ve basically found a niche by pitching themselves where labour should be.
The SDP say lots of sensible stuff, and are, if not outright anti-lockdownists yet, certainly very close to it. Have a look at some of the articles on here: https://sdp.org.uk/sdptalk/
And see this press release from their leader:
“The SDP today announces its opposition to the government’s new COVID-19 restrictions. We call on the government to instead adopt a sustainable public response to the pandemic, befitting the long-term challenges it poses.
The newly-unveiled restrictions demonstrate a failure by policymakers to adequately consider the long-term social and economic health of Britain. Alongside the harm inflicted upon the nation’s struggling hospitality industry, the new restrictions on social gatherings are set to indefinitely deprive many people of the collective experiences which are essential to their sense of belonging, purpose, and humanity.
Besides the long-lasting damage inflicted by the restrictions, these measures also threaten to permanently undermine the liberties and freedoms of the British people. The introduction of ‘COVID-19 Secure Marshals’, ostensibly to help local authorities support social distancing, represents a heavy-handed intrusion by the state into the lives of individual citizens.
“A considerate approach is needed in response to COVID-19,” says William Clouston, SDP Leader. “The government should encourage and enable the vulnerable to voluntarily shield themselves, while calling on the rest of the population to behave in a respectful, responsible and tolerant manner. The virus is here and may remain for some time, which means a ‘stop-go’ approach to opening and closing society is unsustainable and inappropriate.
“Furthermore, some restrictions on personal freedom are unacceptable in a free society. The threat of curfews, limits to social gatherings and the compelled wearing of face masks represent an unprecedented encroachment into the dignity and autonomy of Britons, which we fundamentally oppose. The government’s response to COVID-19 must be communitarian, not draconian.”
Help – I’m turning into a SDP supporter!!!
All that matters now is anti-lockdown or pro-lockdown. Nothing else is relevant.
Utterly agree
I’m just shocked after many years (I remember them being formed) I’ve actually agreed with them on something.
Great start, I can support them on a temporary basis. However if they continue fighting for our rights and liberties and fighting against the lockdown nonsense, it might become more permanent.
Why not join? I have, and I’ve attended (Zoom of course) meetings. You won’t be joining a group of full on lockdown sceptics, but many members are leaning that way, or at the very least are open to debate about the topic. And, it is a pool of people with at least a bit of political clout – although it is a very small party, the leader William Clouston does appear on Talk Radio and things.
I am coming your way…
I thought they were all about identity politics, trans rights, hate speech, New Green Deal, fascists that is…
They/we are anti all of those things. Really. Have a look at the website, particularly sdptalk. There are articles on there anti virtually everything you’ve just listed.
This has probably already been posted as I don’t have time to read all the comments.
Imagewww.bbc.com › news › uk-england…
Web results
Used coronavirus tests handed out by mistake in Birmingham – BBC News
60 minutes ago — One student who was given a used kit said some people had opened and used the testing kits.
It’s an absolute fucking joke! Not only have they just created a potential biohazard contamination problem they have also breached GDPR by revealing the names and addresses of other people who have had tests.
You couldn’t make this stuff up.
Who else can’t wait 2, 3 or 4 weeks after the start of the “circuit breaker” when measures are extended as there are still too many cases. The fact people are falling for this again is unbelievable. Circuit breaker is just 3 weeks to flatten the curve with a PR friendly spin.
Obvious isn’t it? “Just 3 weeks to break the circuit” blah blah blah.
Less people are falling for it this time than in March, but still enough to ensure that it will be implemented regardless.
Surely the purpose of a circuit breaker is that it is triggered by an event that threatens a whole system. Whatever triggered the circuit breaker is then mended/rectified and off the system goes until a completely different fault occurs. You don’t simply keep triggering the circuit breaker ad infinitude without trying to correct the cause.
I’m not an electrician but I’m sure you’re correct. The computer equivalent is “Have you tried switching it off and on again?”, often said humorously but it’s a standard thing to try. The “circuit break” for Covid-19 would only work if it miraculously caused the virus to disappear, which of course it wouldn’t.
It’s a cult. I’m now fully convinced. I went through a few places looking at the hallmarks / signs of cults & cult behaviour. How familiar are these?
1. Opposing critical thinking
– See the numerous academics/doctors being shutdown for questioning the narrative, showing other data.
2. Mind-Altering Practices Are Used
– The purpose of these activities is to suppress doubt. (see mask wearing). Therefore, if one person sees their friends and contemporaries participating in some sort of group chant or denunciation service, they’ll naturally want to be part of the crowd and participate as well. Going against the grain might not only be dangerous; it could be undesirable from a social standpoint as they don’t want to lose their friends.
3. Members Must Seek Permission Before Engaging in Certain Activities
– In addition to seeking permission, members must abide by the guidelines set forth by the leaders. Contact tracing, crazy rules that make no sense, etc.
4. The Group Is Elitist
– Essentially, this means that the group — and its leader — consider themselves to be the cream of the crop. They aren’t mere mortals; they’re on a special mission to save humanity. See Bill Gates or almost any other world leader hyping this up and promising to save us all.
5. The Ends Justify the Means
– How many times have we heard this now? How many are dying because of this insanity through suicide, cancer deaths, etc. but it’s some how framed as acceptable loss for the greater good.
6. A Strong Us vs Them Mentality
– See how they have framed COVID deniers, anti-vaxxers, or anybody that questions the narrative.
7. The Leader Is Not Accountable to Other Authorities
– There seems to be no accountability about anything throughout this, fuck up after fuck up. The chaos and mistakes keep stacking up with nobody being held to account.
8. Shame and Guilt Are Prevalent
– Exactly how people feel when they can’t attend a love one’s death, funeral or visit a loved one in a care home.
9. Group Members Must Cut Ties with Their Families
– Lockdowns have this one fully covered.
10. A Huge Time Commitment
– People have become obsessed with COVID, news watching, altering their behaviours, etc. It’s become a constant talking point and fixture of daily life.
11. A Requirement to Socialise with Fellow Members Only
– They’ve basically done away with socialising, but groups firmly in the COVID camp do seem to quickly ostracise anybody who doesn’t agree with things like masks, etc.
12. There Is Nothing Worth Pursuing Except the Group’s Goals
– Forget everything else. We must flatten that curve.
13. Fear and Dread
– Seen anything positive in the media in the last 8 months? Even if we get through this we have economic collapse & a long recession beckoning.
14. Separation from the Church
– How many churches and religious groups have been basically shutdown? My wife used to go to church every week, she hasn’t been since March.
15. They practice deception
– Deliberately withholding or distorting information, and/or lying. There’s just too much I could list here.
16. They minimise or discourage access to non-cult sources of information
– TV, internet, media have all been forced to not question anything and shoot down anything that questions the narrative. Actively blocking/hiding anyone or anything questioning this madness.
17. They make extensive use of cult-generated information and propaganda
– No comment necessary
18. They make the person feel that problems are always their own fault, never the leader’s or the group’s fault
– How many times have the government blamed the public for rising figures?
Yes – see the latest article on off-guardian from C J Hopkins.
Which is why this is so dangerous. No amount of rational argument will persuade them to change their minds.
Once a critical mass of people are persuaded, the masters of the universe will probably commit an act of biological warfare and release an even more deadly strain.
“IT’S MUTATED!” everyone will scream. Most of the commentators here will switch sides, sites like this will be closed down – not really winnable this one is it?
This is of course pure fiction, they’d never do anything like that.
I’ve noticed that no matter what angle you try to take with these people, whether logical, emotional, statistical or economic they just don’t seem to hear you at all. It’s as though their responses are completely premeditated.
I have found exactly the same with the most brainwashed/zealous. I’m afraid we have to give these people up as lost.
There are however a substantial number in the “go along to get along” group that we can still get to. This is where we must focus our efforts.
Yes I agree. Disappointed in myself in that I wasted half my morning being called ‘selfish’ trying to persuade a zealot over social media, should know better by now but it’s hard to resist sometimes!
Sadly social media attracts the most zealous cult members of all. As this is information in the public domain, rather than an individual interaction, doing this is not a wasted effort. Disrupting their signal is important.
A change of course normally needs just 10-20% of the people who are opposed to the current course of action become active and gain traction- see climate change etc..
Barring that, politicians and the public can and will only be able to change their opinion and course of action after the
catastrophe(s) have occurred.
I expect those to be a combination of hyperinflation, debt defaults, unemployment/depression, concentration camps and vaccine deaths and damages.
Possibly many of them deliberately brought about, in particular sterilizations through these Frankenstein vaccines.
I agree with your analysis. I have brought some friends and family members to the sceptic side but there are a number of relatives of mine who are covid fanatics.
They happen to belong to religious cults and may find the pseudoscience and coercion of the covid cult soothing and appealing.
Yes it really is a cult. The mass public are brainwashed cultists. Check this out, it was posted by somebody else on here a while ago and I have re-posted it a few times. It’s that good. This brainwashing or cult indoctrination has been done “by the book”.
************************
Alexander Whorf (Posted on http://www.lockdownsceptics.org)
Uncanny parallels between what governments have done and Dr Singer’s research on religious cults. Those responsible should be held to account.
Tactics for Psychological Coercion (AKA “Brainwashing”) – Dr Margaret Singer (1921-2003)
1. EXACT REPETITION
Techniques to increase suggestibility and ‘soften up’ the individual via hypnotic or other suggestibility increasing techniques such as extended audio drills, excessive exact repetition of routine activities.
2. SOCIAL ISOLATION
Establishment of control over the victim’s social environment, time, and sources of social support through creating social isolation; removing contact with family and friends, as well as persons who do not share group-approved attitudes.
3. INFORMATION CONTROL
Rejection of alternate information and separate opinions. Rules exist about permissible topics to discuss. Communication is highly controlled. An ‘in-group’ language is usually constructed.
4. ALTER REALITY PERCEPTION
Make the person re-evaluate the most central aspects of his or her experience of self and prior conduct in negative ways. Efforts are designed to destabilize and undermine reality awareness, world view, and defence mechanisms.
5. CONFUSE TARGET
Create a sense of powerlessness by subjecting the victim to intense and frequently confusing, conflicting actions and situations which undermine the victim’s self-confidence and judgement.
6. PUNISHMENT
Creating strong, aversive, emotional arousals in the subject by reactions such as intense humiliation, loss of privilege, social isolation, social status changes, intense guilt, anxiety, and manipulation.
7. CONFORMITY THREATS
Intimidate with group-sanctioned psychological threats. For example, it may be suggested that failure to adopt the approved behavior will lead to severe punishment or the reappearance of a prior physical illness.
This is exactly what has been done to us.
Thankfully we are strong enough to withstand the programming. Clearly, we are in a minority. It will be for future historians to ponder why so many surrendered to the cult.
I agree Richard, it depends on personality type as to whether or not we are drawn into the cult and all its lies. I was thinking about myself and if I have always been one to fight against the tide, the answer was yes. As an example, I am a middle aged woman who according to lots of rubbish put out there, should have my hair cut short, wear frumpy clothes and sit knitting for the grand kids. I have long hair, wear what ever I like and still enjoy partying. Maybe a wishy washy analogy but you get my drift. I will fight against this crap to the end and stick my fingers up to those who feel they have a right to judge me.
Hmm, have you got a boyfriend? If not I’ll take you out
… and why we didn’t.
Sod future historians. They surrendered because they watch (too much) telly and have given up thinking for themselves.
text book
Like all cults this will end one way when the Cult leaders tell the cult members the only way to save themselves is to kill themselves at 8pm on their own doorsteps
Today’s lockdown sceptics includes an amazing discovery: Dr Whitty bears an uncanny resemblance to Dr Beaker from Gerry Anderson’s Supercar! – Toby Young on twitter
Yes, Toby, but the Beaker puppet is much more lifelike don’t you think?
(just a joke!)
https://www.dailymail.co.uk/news/article-8838727/Academics-circuit-breaker-study-admit-death-figures-estimated.htmlE
Yet another mea culpa from one of our circuit breaker specialists.
We should pull the plug on these circuiteers and their political poodles.
https://metro.co.uk/2020/09/28/dr-hilary-jones-questions-whether-democracy-should-be-scrapped-to-fight-coronavirus-13336162/
Democracy has already been scrapped, so I’m not quite sure what the doctor’s point is here. At least it is a very clear public declaration of where the Covid Cult wants to take us.
This is certainly bringing all the fascists out of the woodwork
Democratic society questions whether Dr Hilary Jones should be scrapped/scraped/raped to fight crazy fascists.
Are there any of the stats guys about?
Sorry for the long post, but there’s something been really bugging me for a while about the England admissions numbers and now that the new England NHS “October 2020 COVID Publication” spreadsheet is available from here: https://www.england.nhs.uk/statistics/statistical-work-areas/covid-19-hospital-activity/
I thought I’d have a closer look.
I’m really troubled by 2 statistics: these can be found on the Admissions Total tab and the Diagnoses Total tab.
The definitions for these 2 stats are as follows:
Admissions Total: Admissions – Number of patients admitted with COVID-19 (Last 24hrs)
Diagnoses Total: Diagnoses – Total number of inpatients diagnosed with COVID (Last 24hrs)
It seems to me that the Patients admitted to hospital number reported on the daily Gov.uk page: https://coronavirus.data.gov.uk/healthcare is made up of the total of these two figures.
I made a spreadsheet up using the numbers for September, and it appears (to me anyway) that the majority of the reported ‘admissions’ are from inpatients, i.e. people already in hospital. In some cases that figure is 3 to 4 times the number of people actually PHYSICALLY ‘admitted’ to hospital from outside.
I’ve attached a pic showing September. A couple of examples: (remember numbers are for the previous 24 hours, so I’ve corrected to the actual ‘admitted’ dates.)
September 28: Number of patients admitted with COVID-19 (Last 24hrs): 79
September 29: Total number of inpatients diagnosed with COVID (Last 24hrs): 231
September 29: Recorded admissions figure on Gove.uk: 310 (i.e. the sum of the 2 above)
**************************
September 19: Number of patients admitted with COVID-19 (Last 24hrs): 33
September 20: Total number of inpatients diagnosed with COVID (Last 24hrs): 204
September 20: Recorded admissions figure on Gove.uk: 237 (i.e. the sum of the 2 above)
***************************
This is true for the whole of September (and all previous months).
I hope you can all see where I’m going with this, but it looks to me that the ACTUAL ‘physical’ admissions number (i.e. people actually going into hospital with Covid-19) is dwarfed by the ‘fake’ admissions (i.e. patients already in hospital being tested positive, then being called ‘admissions’), sometimes by a factor of 4 or 5, or even more.
Can someone have a look and prove me wrong, please?
Because, if I’m not wrong, it’s one hell of a misleading (to the point of downright lying) figure to report daily. They are essentially passing off inpatient diagnoses as new admissions.
If you are correct (as I am sure that you are), this is pure dynamite. It needs Carl Heneghan to take a close look at it. If you can find his e-mail address somewhere (maybe Toby has) then I would send your findings to him and for verification.
I’m aware that Heneghan looked at the Daily Admission sheets as they were coming out and suggested something was amiss; I think he said a third were ‘fake. But with the monthly report it is clearer to see.
Huge caveat: I think my observations are correct.
It’s carl.heneghan@phc.ox.ac.uk
Found here: https://www.phc.ox.ac.uk/team/carl-heneghan
Thanks, matt.
I’ll wait till someone tells me I’m not talking rubbish first.
you are not talking rubbish
Thanks, Ian.
Add to that, the numbers tested on admission, say A&E, who aren’t going in for respiratory conditions.
https://twitter.com/ClareCraigPath/status/1315966137499291649
I’m fairly certain this is correct. My wife and I are going into hospital tomorrow for a planned c-section, and we got covid tested (were made to) yesterday. So, if she is positive, she’ll be counted as a ‘covid patient’ despite having no symptoms, not being in hospital because of covid, and nothing about the visit on any level relating to covid.
What about your new baby when he/she is born? Will your wife be able to establish crucial early contact with your newborn, or will the Covid Constraints interfere?
I hope not,for all your sakes.
Best wishes
I’ll let you know after the weekend! In fairness, we didn’t get that for the first one either (pre-Covid obviously) for legitimate reasons because of lots of things going wrong and emergency surgery and stuff.
Good luck to you both, and your new baby.
Only an anecdote, but somebody told me about a woman in Belgium who ‘tested positive’ on entering the hospital for the birth of her baby, and when it was born they made her stay six feet away from it.
Horrible!
Best wishes to your wife, and you, of course.
The statistics have been deliberately and systematically presented right from the beginning in order to present the most frightening picture possible of Covid.-19.
Why should they stop now?
When analysing this data it is worth paying attention to the definitions (on the same page):-
• Number of patients admitted with COVID-19 in last 24 hours
Count in this data item any person admitted in the last 24 hours who was known to be positive at admission under confirmed COVID-19 patients (with age split)
• Number of inpatients diagnosed with COVID-19 in last 24 hours
Count any patient diagnosed between midnight (00:00:00) to 23:59:59 on the day before reporting (with age split). Only include first positive tests within the admission – so a patient should not count on this line for a second time if they have a repeat test within the same admission which is also positive. Do not include patients who were diagnosed positive prior to admission to hospital (ie exclude patients where the result of the test was known at admission – patients who were tested prior to admission, but whose results were not known until after admission should be included), or patients who were discharged, or died, before the diagnosis was made. Diagnosed in this context relates to the point at which the result is known to the trust.
• Estimated admissions
This is a derived figure, it adds those patients who are diagnosed with COVID-19 in hospital to those patients who were admitted to hospital with confirmed COVID-19. It represents a count of patients who, on a given day, have been added to the count of people in hospital with COVID-19. A worked example – the 74 patients in hospital who received positive test results on 4 July are assumed to have been tested on 3 July and it is at the point of testing that they become a patient in hospital with COVID-19. These 74 patients are then added to the 72 patients admitted to hospital with confirmed COVID-19 on 3 July to create an Estimated Admission figure of 146 for 3 July.
Thanks, Achilles
Yes, I did read that. It still suggests to me that they are ‘massaging’ the numbers; or, at least using a very loose definition of ‘admissions. That’s why I asked for other opinions.
I’m sure they are too. Unfortunately they can hide so much in the definitions, the lag, etc. it can give you a headache trying to unpick it!
Yup.
Again, thanks for the input.
There is still an underlying problem, in that ‘confirmed Covid-19’ seems still to be relying on the notorious PCR positives, to the exclusion of other diagnosis routes.
It’s all bollocks mate (not your analysis v good btw) the wankers are fudging it to fit their contrived narrative.
The cards are stacked against us, the stats are meaningless, crap.
They know it and they know we know it.
The testing is crap, useless, a sham.
They are the best conmen going, that’s why they are in charge. They haven’t got this far by being honest. I wouldn’t buy a 2nd hand car off them.
Arthur Daley wankers.
Thanks, appreciate that.
Credit where credit is due. You will tie yourself up in knots trying to make sense because there is no sense to it, that’s the point.
As I posted yesterday, a local company received 37 test kits for the employees as requested by the MD. All the swabs were immediately placed in the phial without testing anyone and sent back in. All 37 diagnosed as positive. Is that not a fraudulent scandal???
Yes, it stinks and it grinds my gears knowing we are being shit on.
I should add that my point about looking into this is that, like everyone else, I’m sick of the lying; feeding the public with fake figures about ‘cases’; Covid deaths which aren’t Covid deaths, etc.
Now that the debate has moved on to hospital numbers and admissions, it has to be pointed out that this number is also fake. There is no way all these people being tested in hospital are being treated for Covid; to call them Covid admissions (regardless of the NHS definition of the word) is disingenouous, at best, and downright lying, at worst.
Remember, this ‘admissions’ figure (among others) is what Handjob and Bojo are using to drive policy right now. It’s also the figure the Beeb, et al. are spouting to the masses.
I would send it to Deborah Cohen as well (deborah@drdeborahcohen.com). I have raised similar points with her previously, but without this level of data, she might take an interest in this data.
I think you’re onto something there. I haven’t analysed it myself, since I have a healthy suspicion of all figures relating to Covid. But I think that the following CEBM item is relevant. Although couched in restrained evidential terms, the implications are far-reaching in terms of reported numbers from hospitals. :
https://www.cebm.net/covid-19/probable-healthcare-associated-infections-in-england/
There are so many potential layers of inaccuracy in this area that it’s almost impossible to untangle the truth of what is happening.
Thanks, Rick.
Yeah, I’ve read that; it may be the item I referred to above.
As I said above, Heneghan, et al looked at the Daily spreadsheets; the monthly report I used/referred to in my ‘analysis’ breaks the numbers down and shows the huge difference between actually physically being admitted to hospital, and virtually being admitted, i.e. already in hospital and getting a positive test result.
I worked in a Hospital ‘Rapid’ Discharge team in Brighton until I retired 3 yrs ago which covered A/E dept. Someone in A/E who went home that day or who stayed overnight on short stay Ward or medical assessment unit ( can’t recall exact time limit) was not counted as an Admission. This was crucial and would be good to know what’s going on now with definition of ‘admission’ ??
Will these help?
https://principia-scientific.com/scoop-govt-scientist-exposes-covid19-hospital-beds-scam/
and the previous related article
https://principia-scientific.com/uk-govt-play-fast-loose-on-covid-data-to-justify-more-restrictions/
MRG, you’re a gem; I’ve been looking for that ‘beds scam’ link. I read something about it here on LS, but couldn’t find the link, so ta much, mate.
The last figure in the first article I cited, labelled “NHS England: COVID-19 admission & inpatient case load”, seems consistent with your numbers.
Best of luck.
Re: False Positives and False Outbreaks
From a friend about his mother 101 years old!!!
“This concerns me regarding xxxx’s home
There are only 16 residents there and so far there have been no positive
tests, based on monthly testing, but I’m sure that statistically there could
well be a false positive cropping up sooner or later.
We haven’t been into the home since February so all we’ve been able to do is
wave through the window and have short simultaneous conversations on the
phone, which she can’t hear very well anyway.
I wonder if we’ll ever get the chance to give her a hug ever again”.
I honestly don’t know how they can get away with treating people like this.
It astounds me and where are the CQC in all this, their silence is deafening. Another useless quango.
They can’t get away with it:
https://www.gov.uk/government/publications/visiting-care-homes-during-coronavirus/update-on-policies-for-visiting-arrangements-in-care-homes
CQC complaints procedure:
https://www.cqc.org.uk/contact-us/how-complain/complain-about-service-or-provider
Forgot to say – the guidance is like the “ion close contact” callus for mask wearing by shop staff, a get out clause for Government and all blame can be put onto the individual care homes etc as they should have done a risk assessment for each individual and let the visit go ahead but they did not so the family should have challenged them.
All very sneaky and they always give themselves an out so the blame falls to someone else – companies, care homes, councils etc.
Very sneaky indeed. Hopefully though, I can hear the judge at their trials saying “Inadmissible – off with their heads !”
Ditto the same with my husbands mother. She’s 97 and I wonder if we’ll ever see her again. It’s inhumane what these b’stards are doing, they are psychopaths!
Amnesty International gathered the evidence. Its report has been ignored.
But it will come up at Wancock’s trial.
Yes, I hope so. The bastards need to pay for this.
everytime Labour gets a new useless leader, the ones from the past look like giants.
remember we missed Ed when Corbyn came in?
The tramp looks like an intellectual titan in comparison to Keir “forensic” Starmer
“remember we missed Ed when Corbyn came in?”
Speak for yourself. I preferred Corbyn. To both of them.
Although I did not vote at the last election, I nevertheless would not have been upset had Corbyn won. (The alternative being this appalling clown we now have.)
Corbyn was a poor leader though. He should have guaranteed Brexit and he should have vigorously defended himself against the antisemitism smears.
I mostly agree with your analysis – except – why should he have ‘guaranteed’ Brexit? : he actually offered more real democracy (something we”re sadly now lacking) in a situation where the nation was divided, and Brexit was supported by a minority of the public – as opposed to the decisive 1970s vote.
But hey-ho – it’s a dead issue – now proven irrelevant to the key issues.
I agree with you on preferring Corbyn to either of the Blairites. Not because I particularly agreed with him about anything much, but just because he seemed at least a believer in something, rather than a soulless Blairite.
Whether vigorously defending himself against the comical “antisemitism” smears would have done any good is questionable. They were coming from traitors within the Labour camp, fed by establishment organs, and all such smears are almost impossible to defend against in modern US sphere societies anyway.
Regardless, any and all Labourites facing that kind of dishonest smearing fully deserve what they get, since you do not get to the top in the Labour world of the past few decades without vigorously pushing the “racist”, “sexist” and “homophobe” smears as weapons against dissenters and dissenting opinions.
Hoist on his own petard.
I was thinking the same. I doubt Corbyn would have made such a lash up.
Pretty clear Corbyn would have been worse, as a true believer coronapanicker, on record as describing herd immunity as “eugenics”.
I’ve added a chunk of stuff to my website including a rallying call to action on the ‘take action’ page. Please share amongst anyone you know – particularly non-sceptical folk and/or students.
https://covid19thelowdown.wordpress.com/
go nocheese!
Very good. Can I suggest the links should not open in a ‘new tab’. It makes it a bit less usable as you navigate. Some graphics to illustrate the statistical points would be really good as well (e.g. very large/very small side by side bars or piecharts).
Oh, and on hospitalisations, mention that Gov stats seem to ignore discharges. I think Carl H has raised this anomoly.
Thanks for your suggestions!
Prefer ‘new tab’. Especially when I’ve taken ages to get to the right LDS comment !
And on the Action tab, maybe links to KBF, SaveourRIghts, off-guardian, etc. ?
I’ve turned it off for now but you should be able to still access it in a new tab by right-clicking the link.
Nice work.
Good for you!
This is excellent work, it really is.
Good effort! Might be good to add under the deaths section the estimated deaths due to lockdown (e.g. NHS not treating people etc), which I think was reported recently as around 74,000 (from Government’s own analysis). Can’t find the source now, anyone else know?
This is really great, I’ll forward it onto some people who are having trouble getting through to people they know.
One thing I’d recommend is to separate the bullet points. With all the underlining as well it feels a bit “wall of text”‘ish, if the bullet points were separated I think it would be easier on the eyes.
Thank you, I’ll edit to now.
May have been posted, if so apologies..
https://www.geekwire.com/2020/experts-foresee-triumphs-tragedies-worldwide-quest-covid-19-vaccine/
Chock full of self important statements and quotes…one of my favourites;
“We’re going to probably see a lot of deaths,” said Lynda Stuart, deputy director for vaccines and human immunobiology at the Bill & Melinda Gates Foundation. “It’s going to be a great inequity and tragedy that will unfold.”
Also;
“I think that vaccines are going to have to be made free to the individual, to recipients,” Fuller said during a VIP session for Summit attendees. “There’s great motivation for that. You look at the great economic toll that COVID has had. I think that businesses, I think governments, I think they will all be very motivated to try to get this to as many people as possible.”
Just an teeny tiny fib there…I’m pretty certain it is the madness of our respective governments that has done the really damage.
I think we will enter a decade at least of severe information warfare. Those that have been central to this have created a huge problem for themselves but they hold tremendous power. We see examples of rcebent attempts to ban alternative media and opinion, no more so than the temporary block on Google of the GBD. That’s just a taster.
They’ve clearly chose a side here, and it reality continues to show that the cure has been many magnitudes worse than the disease, they’ll use that power to cover their tracks, to hide sources, to invert public opinion in whatever way they can. They cannot turn back. Its a systemic reaction to the turning of real world events, I can’t see it being anything but a full frontal attack from here.
Exhibit A: Add in a German magazine today
yukyukyukyukyuk
Ein Volk, ein Reich, ein New World oder!
I’m sure it’s just a coincidence, conspiracy theory and not an all out attack on humanity!
Assume that’s meant to be a V-sign? The photo on my screen makes it seem as though she’s giving the finger to the whole thing?
https://www.bbc.com/news/world-europe-54537519
According to the BBC, it is an ad paid for by Visit Berlin. I have just sent Visit Berlin the following email (happy for others to copy and paste – address is hallo@visitBerlin.de)
The BBC (and other English speaking media) are reporting on the above ad.
I am quite happy to add Berlin to the list of locations to boycott permanently when this madness is over.
Perhaps you should remember that Berlin was the centre of a form of madness between 1933 and 1945, for which your nation has been apologising since.
A.k.a. World War 3.
“China and Russia were among 15 countries elected to the UN Human Rights Council on October 13, drawing sharp criticism from rights groups and the United States over their abysmal human rights records.”
Hmm, well setting aside the dubious merits of the UN, Putin’s relatively free Russia ought to provide a half decent counterbalance to China’s oppressive authoritarianism.
(Don’t tell MI6 I said that. Russia’s still the “official” enemy.)
We in the West are hardly in a position to be bleating about human rights at present.
Quite, Julian Assange being at the top of a very long list really.
First off quit playing in their game- these people have no intention of letting up and know damn well that Covid is a con and they are playing that con to get to their economic desires.
Do not enter their hall of mirrors by endlessly debating whether “cases” are going up, down or sideways. Everyone with half a brain knows the “case” game is rigged and devoid of real meaning.
Secondly how much of a f*ckwit can this Hancocks*cker actually be?
This tool for the modern-day Pharma-Tech robber barons says the following
Herd immunity is a flawed goal without a vaccine, even if we could get to it, which we can’t.
So I guess herd immunity isn’t so flawed with a vaccine. No doubt in Hanprick’s world we will all be golden and herd immunity will be bestowed upon us if only we pay the tithe to the Pharma Vaccine Vampires.
The second central claim is that we can segregate the old and the vulnerable on our way to herd immunity. This is simply not possible.
WTF is this technocratic tyrant talking about? We’re pretty much already there. It’s called care homes/nursing homes. You know those slow motion abattoirs where you sick f*cks profit off the misery of the elderly by segregating and isolating them massive amounts of toxic Pharma pills every day and stuff them into squalid living conditions.
But please tell us how much you care about the elderly and use that as emotional blackmail whilst you try to cover up and run away from the fact that you slaughter tens of thousands of these elderly in March/April and then used this for your hideous purposes.
These lying cynical bastards need to be on trial.
Do not enter their hall of mirrors by endlessly debating whether “cases” are going up, down or sideways. Everyone with half a brain knows the “case” game is rigged and devoid of real meaning.
This is exactly it. This is why I now skip Toby’s daily updates, because he still talks about “cases” like it’s a thing. “Oh, but cases are actually going down”, it’s completely irrelevant! Once you start debating the metric that they’ve thrown down then they’re always going to win. They can always manufacture more cases and then where’s your argument?
I’ve said before – always start the argument with “it’s nothing worse than a mild flu”. Everything you argue with should stem from this. Logically, there’s no way out of it. They’ll use appeals to emotion to argue back but there are plenty of examples from our side to counter this too.
The best part of it’s only a mild flu is the vitriol that you trigger in return.
Haha, do they get angry? I’m quite lucky in that no one I’m close to thinks it’s anything other than nonsense, so I haven’t really had to argue it with anyone yet.
Heavily triggers a coronaphobe. My family agree it’s a nonsense also.
Rule #1- don’t let your oppressors set the terms of the debate.
The discussions should be focused on the tactics and methodologies we should be exploring to convict these criminals- not to be in negotiations with them.
Yes, but once the general public realises that “cases” are nonsense, the government’s mechanism for controlling the public evaporates.
Agreed, talking about the nonsense of PCR tests etc is a good follow up, but I’d never start an argument on the basis of cases being low.
If herd immunity is a flawed goal, how did the human race survive until the 20th century?
pure luck as we didn’t distance or mask up either.
By viruses, bacteria etc killing off the weak. Only the strong immune systems survived to reproduce into the 20th century.
Hence why Africa and similar countries have lower death counts from CV19. They have many fewer elderly and frail (fat, diabetic, high blood pressure, heart transplant and cancer survivors) available to succumb – some commentators suggest c. 50% of UK, US populations have these sorts of co morbidities.
Time Magazine have a really concerted go at Sweden:
https://time.com/5899432/sweden-coronovirus-disaster/
Selective reporting, yes they are the two countries with higher figures but if you look down the table to the ‘low mortality’ countries, they have not reduced theirs by any significant amount if at all:
Of course missing the obvious point that a comparison of lockdown/not lockdown can not be made between countries by mortality rate. Mortality rate depends on the age & health make up of the country, the quality of it’s healthcare, the severity of previous flu seasons, which hemisphere it’s in, care homes, etc, etc. A whole wealth of factors. The only comparison you can really make is the shape of the mortality curve because, remember, that was what lockdown is supposed to be for. Flattening the curve! Sweden’s curve should look completely different if lockdowns have any major impact.
I really can’t understand the comaparision.Swedn as a non lockdown country had a slower slope down with deaths than Spain. But when the second wave started in Spain enormous rise of cases and slower death would obviously decrease death in the second wave.That second wave has just started in Sweden from currently a very low death rate in Swednen.
Calling what has happened in Sweden a disaster is patently absurd and 100% political
If they mean the care home disaster, then it’s nothing that the UK and some US states haven’t done on a far worse scale.
I looked at the weekend football results and based on the data I concluded that teams that conceded the most goals tended to lose more often than teams that didn’t. The objective of every team should therefore be to not concede and it should be possible because some teams showed it was possible.
This is effectively what most of these comparison studies do and are not particularly useful.
Also seems conveniently timed to be more of a political attack than a scientific exercise.
Bet they haven’t mentioned Peru or Belgium
This is really a hard hitting publication in the fight against GBD used for the US audience and also evidently pro mask.It has been done in conjunction with Tegnell/Gieseckes enemies in Sweden. They are almost discussing like the pandemic has ended just as the second wave will also affect the countries lauded in the article.
It’s dripping in obvious bias. From one single table showing that mortality rates were high overall in Sweden (but continuing to improve in comparison to others where the crisis continues), they jump straight in. No kissing.
“Countries that locked down early and/or used extensive test and tracing—including Denmark, Finland, Norway, South Korea, Japan, Taiwan, Vietnam and New Zealand—saved lives and limited damage to their economies. Countries that locked down late, came out of lock down too early, did not effectively test and quarantine, or only used a partial lockdown—including Brazil, Mexico, Netherlands, Peru, Spain, Sweden, the U.S. and the U.K.—have almost uniformly done worse in rates of infection and death.”
There you have it. Correlation equals causation. SCIENCE
That puts it in the ‘pure propaganda’ bin.
Further interesting in the article a haste to speak about the second wave.This will affect all Euroean countries and compare Austria and Sweden in the second wave.Same size population.Austria lauded for low mortality lockdown etc now has 5 times more ICU adm than Sweden.Cases also more but cases always difficult to compare because of masstesting etc.Really which counts is deaths and ICU and at the moment the new wave in Central europe seems to be worse than i Sweden.We can only judge after the wave and Sweden will get its share but most interesting to compare with the others.
In the future, will people be advised to have a test if they think that they have the flu,a cold,cough,hiccups,headaches(feel free to add your own minor ailments)?
Where would it end?
Yes they will and it wouldn’t/won’t. Possibly in a few years time the hysteria would burn itself out
Like the virus will,a lot sooner than that.
They are still looking for the shoe bomber at Heathrow.
So the next one just put it in his y-fronts instead
What future?
Biochips instantly detecting active viral prescence. Big money has already been poured into this.
Maybe? At some GPs surgeries in London you can’t register as a patient without an HIV test. They were incredulous when I refused. What I actually wanted to say was why would I subject myself to an invasive and stressful test for something that I am extremely unlikely to have since I have no symptoms nor any risk factors… but I allowed myself to be bullied into it.
https://www.zerohedge.com/medical/public-humiliation-hitachi-develops-fish-bubble-enforce-social-distancing.
“If a person violates the 2 meter rule, the fish “escape” the bubble and presumably the person is warned to change their behavior…”
It will be mandatory to carry a tape measure around with you next.
Best of luck with that in Sainsbury’s then.
Are this lot taking the piss??
https://youtu.be/vzVGsy1e2ao
Ah the “circuit breaker ” which is only two…or three weeks.. Well the Glasgow circuit breaker has only 9 days to go , shall we see if its successful first ?
The only country in the world I know which has used the description ” circuit breaker ” which probably comes from some 1960 s epidemiology text book is Singapore. This ” temporary measure ” was actually tightened after 2 weeks and is largely still in effect.
https://en.wikipedia.org/wiki/2020_Singapore_circuit_breaker_measures
Yeah, and will it be two weeks here?
Like the last one was three weeks?
It’s not a circuit-breaker it’s a resistance breaker. A slap-down to quell resistance, challenge apathy and obfuscate the data.
So when does the economy go to sh$t or are we overreacting? Is the end of this month the last furlough payment? Why are we not seeing more of an unemployment impact or are the media just underreporting it?
I honestly don’t see people waking up until the job losses kick in.
Unemployment figures have been manipulated to suit the prevailing political agenda for decades. Expect nothing different now.
Ministers preparing for four million unemployed because of Covid crisis
https://www.telegraph.co.uk/news/2020/10/01/ministers-secretly-preparing-4m-unemployed-due-economic-effects/
The end of this month is the end of furlough. I imagine they’ll just print more money and extend it, because like you say, until there are serious job losses this will just meander on.
There’s already lots of second hand evidence of people competing with thousands of other people for one job, or being unable to get basic jobs when previously it would have been easy.
We’ll see how it plays out, but they’ll try and avoid the situation as much as they can.
Our program here got extended. I was truly hoping the end of CERB (Canada Emergency Response Benefit) would wake up the sheeple, but it’s just transitioned to EI and has been extended to the end of September 2021. I suspect your government will keep going to the money tree as well.
Economy been shit for years, the numbers being pumped out are like Fergusion’s modelling – totally fictitious and made up.
Just got back from the beach. Is the pig dictator still ruining the country?
Yep. God I envy anyone who lives near a beach.
Masks
“James Grundvig says the masks are the Swiss Army knife of the architects’ tool box;
1. They control people and make them subservient.
2. They allow AI face recognition software to identify people with masks on and off;
3. They prevent full communication using facial expressions.
Dr. Russell Blaylock warns that not only do face masks fail to protect the healthy from getting sick, but they also create serious health risks to the wearer. The bottom line is that if you are not sick, you should not wear a face mask.
The end goal of masks is to make you fall
in line and to roll up your sleeves in the
>biggest biological experiment in history.
Dr. Russell Blaylock
“As for the scientific support for the use of face mask, a recent careful examination of the literature, in which 17 of the best studies were analyzed, concluded that, “None of the studies established a conclusive relationship between mask/respirator use and protection against influenza infection.” Keep in mind; no studies have been done to demonstrate that either a cloth mask or the N95 mask has any effect on the transmission of the COVID-19 virus. Any recommendations, therefore, have to be based on studies of influenza virus transmission. And, as you have seen, there is no conclusive evidence of their efficiency in controlling flu virus transmission,” concludes Blaylock.
Conclusion
Gary D. Barnett, writing about how the beauty of life is being destroyed by lockdowns and masks says, “All of this ugly absurdity now exists, but the most beautiful thing in life is also being destroyed before our eyes. That is the beauty of love and caring. It was once said that “love is a many splendored thing,” and that may be an understatement, as what more defines the human spirit than love? Today, people are wearing harmful and useless masks; they are told not to get close to any other; they are voluntarily, for the most part locking themselves inside home prisons and are not even allowed to work or be with co-workers. People are becoming unrecognizable zombies, frightened of all strangers, friends, and even family. Romance and passion are shunned and in some parts of the world forbidden due to this virus hoax, so many have acquiesced to this travesty, and now most all communication is via a cold and impersonal computer screen.
The idea of a robotic humanity without feeling now seems possible, and is even being promoted; and in some parts of the world, it is being actively sought. This insanity is no longer science fiction, but is on the verge of reality. No good can come from this horror.””
https://drsircus.com/general/final-words-on-masks/ [the webpage is always very slow to open]
While out on my five mile circular walk this lunchtime i noticed an older couple (maybe late 60s early 70s) cycling towards me. He maskless her masked up and we’re in the middle of rural England! Half an hour later is see them coming towards me again on my return leg of the walk. This time I notice that she has pulled the mask down over her chin and this time I notice, I kid you not, her face was a strange shade of grey, completely ashen almost like a corpse on a bike and I found myself wondering whether lack of oxygen uptake had led to that skin colouration.
Yep, she was grey for exactly that reason:
Your blood carries oxygen around your body, and when this is disrupted, you see a discoloration. The disruption may be to the flow of blood itself, which produces paleness or a gray tint to skin tone. When you experience a lack of oxygen, your blood may still be flowing, but it changes color.
I really can’t see how people that age can think wearing these things is a good idea.
That mob get all their news from the MSM. They’ve been conditioned into being sheep.
exercise is contraindicated with masks = hypoxia
I think this is what depresses me the most, the overall human interaction in society is eroding with mask wearing and making people suspicious that the majority of the population are diseased.
Mask usage (especially outdoors) has been a very useful litmus test to identify the brainwashed/zealots.
I heard someone joke that mask wearing outdoors is like having a wank with a condom on! What the hell is wrong with people not allowing oxygen into their lungs!!!!
I said to a couple of strangers in the pub who I got into conversation with last night when we discussed masks, they were all for them, protecting others from themselves, but only as long as they were standing up with them on sitting down drinking was completely different. I said that masks are a very visible way for the government to gauge support for their policies, lots of masks support, no masks – oh dear, they disagreed, probably becasue they neever thought of it like that before. Funnily enough the conversation ceased right after that.
So these tossers have fallen for the “I wear mine to protect you” propaganda. Presumably because they saw it on a government billboard.
Next time ask them how this magical one-way filtration system actually works.
AI facial recognition with masks! That would throw up more false positives and negatives than the PCR test.
Don’t know if this has already been posted, but the laws they are implementing at the moment are very, very concerning.
https://publications.parliament.uk/pa/bills/cbill/58-01/0188/200188.pdf
Which will apply to all of the below:
Any police force, The National Crime Agency, The Serious Fraud Office, Any of the intelligence services, Any of Her Majesty’s forces, Revenue and Customs, Her Majesty’s Revenue and Customs, The Department of Health and Social Care, The Home Office, The Ministry of Justice, The Competition and Markets Authority, The Environment Agency, The Financial Conduct Authority, The Food Standards Agency, The Gambling Commission.
This Bill was being debated a few weeks ago, does this mean it has passed into law?
We are going to have at least half a dozen of the above agencies hunting us down.
I think that was the first reading -?
It’s being heard again tomorrow – this off FB:
Wickedest piece of legislation since Hitler’s Enabling Act.
Cardiff clown at it again. Travel from English Covid hotspots to wales banned… And how is that going to be enforced, assuming anyone takes notice? Rebuild Offas Dyke?!
I’m not sure of the legality of such a move. We are 4 nations but 1 sovereign country.
My thought exactly. Surely we are UK citizens? English rules are I believe guidance, but Welsh are law. I suspect unchallenged as no one wants to “kill granny”
Our passports are issued as The United Kingdom of Great Britain and Northern Ireland, so the three mainland nations are not even identified separately.
Mr fucking plod on the Welsh side of the border will be checking number plates using ANPR to see where the vehicle’s registered.
Work. Assissting vulnerable person. Visiting grave of loved one.
C’mon Tenchy, use that imagination.
What a bizarre claim.
I smell bull shit again. Is that like the fifty thousand cases we were going to have by today!!
What sort of a stupid prediction is that?! Pick a number, any number…
https://www.dailymail.co.uk/news/article-8838727/Academics-circuit-breaker-study-admit-death-figures-estimated.htmlE
Just imagining if I said to a client ‘Your holiday to Mauritius will cost between £3,000 to £107,000’. Strictly speaking could be true but I would not last long in business.
I think I said similar yesterday. If I told my boss I’d generate between £3k and £107k revenue this year, I’d be out of the door.
There’s a great quote from one of the people who predicted those numbers, when asked what would happen after Jan… they just say that things will simply go back to where they were. No lives ‘saved’, only deaths postponed.
Whats even more bizarre is that people will believe this.
Yip, make up a massive range of potential deaths and hey presto, they’ll be correct somewhere within the range. Christ how can people not see through this shite?
Its truly mind boggling that people believe it. Although I do believe there is a shift here with more and more lockdown sceptics. Many people have had enough but feel powerless.
That may be true. However, I feel we are a gutless nation and even if everybody came around to think like us, what would they do? I know what I’d like to do!
Of course. And it’s win-win. If this ripple is the usual seasonal rise in infection (and this is so far the indication), then it will be because of the measures taken. If it rises above the current insignificant level (but well within normal bounds), then it will be proof of the need foe extended/harsher measures.
Absolute garbage, straight out of the 500K Ferguson playbook.
Repeating exactly the same propaganda as before shows these idiots are a one-trick pony. They have no imagination or creativity.
If they extend the timescale out they can keep saving lives indefinitely.
Between 3,000 and 107,000. Well why not just say between 0 and 110,000? Just a euphemism for haven’t got the slightest clue. And these are “professors”. Pathetic.
More Fergie modelling – aka ‘fiction’.
if we lockdown, people die of old age rather than covid. they still die. I don’t see the point
no margin for error there is there then
3,000 additional deaths is _2 days’_ worth of additional deaths. It’s not worth mentioning.
The only crumb of comfort in this madness is that if you think it’s bad in England, the Welsh,Scots and the Northern Irish are worse off than we are.
Yes there is a very sorrowful ambience here in N I today
Don’t worry, we won’t be far behind. I give it till Monday afternoon at the very latest.
The problem is, we get to subsidise their governments’ nonsense.
Who would have thought?
Amazon to dodge UK digital sales tax, but third party sellers will still have to foot the bill
Google also looking to dodge the tax.
Saves Rothchild paying himself. Cuts out the middle man.
Baldrick has a cunning plan:
“Kier Starmer. Well timed, well delivered, and absolutely right. My guess is a significant majority of voters, regardless of party loyalty, will back him on a 2-3 week circuit breaker.”
What would his boss, Blackadder have said?
“Baldrick, your head is as empty as a eunuch’s underpants. Am I jumping the gun, or are the words ‘I have a cunning plan’ marching with ill-deserved confidence in the direction of this conversation?”
He and Boris will work together. Good cop bad cop. It’s all a show for the sheeple.
This is worse is bad cop and badder cop
More like tweedledumb and tweedledumber.
https://www.bbc.com/news/uk-england-birmingham-54539328
Headline: Used coronavirus tests handed out by mistake in Birmingham
Yuck and then stick that contaminated ear bud deep into someone else nose.
Can anyone tell me if there has been any hard evidence or anyone speaking out about falsified Covid death certificates? I have heard stories of this happening but nothing since.
I would think it’s very hard to prove.
I have seen a few people on social media complaining about it with some family members but doesn’t seem to reach the MSM. Any wonder!
Yes – ironclad ‘proof’ is quite difficult, given the degree of ‘professional judgment’ involved and the lack of counter-evidence in the form of post-mortem examination.
I know of someones terminally ill partner who had Covid put on the death certificate. Like most people in that position they know it is wrong and the partner would have been upset by this – but unfortunately they don’t want the stress of fighting the NHS bureaucracy machine.
I do know that in the US for example, due to the structure of health care there is a financial incentive to have Covid on a death certificate above over causes. I think the Medicare pays out $2000 more for Covid than flu.
In the U.K. it was / is a connivence measure only. With a Covid death one person can sign off without ever having to have a GP attend / autopsy or second opinion etc. It’s the stuff of Dr Shipman’s wet dream.
Under Islamic law a dead person has to be buried within 24 hours of death. Relatives are given the option of having Covid on the death certificate and no autopsy or wait until the results of the autopsy in 2 weeks time. Guess which one they opt for.
https://fort-russ.com/2020/06/empty-coffins-empty-hospital-brazilian-mps-expose-biggest-covid-19-hoax-known-to-date/
The UK government is completely abusing it’s power, on top of what they are doing already we now have this very sinister Bill being rushed through, definitely Covid 1984 stuff, details from Big Brother Watch –
Whilst the country is distracted fighting a pandemic, the Government is rushing yet another authoritarian Bill through Parliament – the Covert Human Intelligence Sources (Criminal Conduct) Bill.
The “SpyCops” Bill would allow state spies to commit crimes in the UK and overseas with impunity — without even exempting crimes like murder, torture and sexual offences.
These extreme powers to immunise state crimes from prosecution would be handed to a broad range of agencies — from police and MI5, to the Department of Health and even the Food Standards Agency.
This is being rushed through Parliament at breakneck speed with insufficient scrutiny. Tomorrow evening, on Thursday 15th October, the Bill will complete its passage through the House of Commons.
Just this week, environmental campaigner Kate Wilson was in court fighting for justice. She was manipulated into a romantic relationship for two years by Mark “Stone” — who she later found out was Mark Kennedy, an undercover police spy.
But this Bill would prevent victims of state spies from seeking redress, by protecting those who commit authorised crimes from civil liability forever.
Police spies have abused innocent campaigners in the UK for decades — from environmental activists to trade unions and race equality campaigners. Undercover police even infiltrated the grieving family of the murdered black teenager, Stephen Lawrence, during their quest for justice.
Undercover state agents have been involved in conflict too. Former Prime Minister David Cameron found they were responsible for “shocking levels of state collusion” in the murder of lawyer Pat Finucane in Northern Ireland.
Currently, prosecutors decide whether it’s in the public interest to trial undercover police crimes. But the SpyCops Bill would bypass prosecutors entirely, allowing state agencies the unprecedented power to declare serious breaches of UK law ‘lawful’, as long as agents had an internal authorisation.
I contacted my (prominent Labour) MP about this a couple of weeks ago. He replied yesterday:
Dear John
Thank you for contacting me recently about the Covert Human Intelligence Sources (Criminal Conduct) Bill.
On Monday, 5 October 2020, the House of Commons considered the Criminal Conduct Bill for the first time.
This Bill will allow covert human intelligence sources (CHIS) who are embedded within terrorist organisations or organised criminal gangs to carry out specific, authorised criminality, with immunity from prosecution. This would put a system that is already being operated, currently on the basis of an implied power under the Security Service Act 1989, on a statutory footing.
As the Bill progresses, I will be looking to improve its vital safeguards so that the public can have confidence in the process.
Thank you once again for bringing this important issue to my attention. If you would like me to raise any specific issues with the Government on your behalf, please do not hesitate to contact my Office.
Good work. It is guaranteed to be misused, they are widening the definition of terrorist organisation to include a much wider group of people – basically any one deemed an enemy of the establishment! Some lockdown sceptics have already had their houses raided at dawn – to search for ‘anti vaccine’ material – which is basically just an excuse to intimidate dissenters. We now have a Police state operating for the interests of Global businesses against normal citizens.
I said the same and asked him to oppose it.
I posted about this below. It truly horrifying stuff. One of the absolute basic foundations of society and democracy is that nobody is ever above the rule of law. This is going to totally rewrite that and say that potentially even restaurant inspectors are free from committing criminal acts. It’s absolute total madness.
Where were the “opposition” parties on this?
Sorry, I didn’t see your early post. It is frightening that something of this importance is being passed without any scrutiny in parliament or the media. Police state stuff.
No problem. I’m sure I wasn’t the first to post it either. The more attention this gets the better.
The rule of law ended in this country on 23rd March. The state, and especially the executive branch, is now out of control with no checks and balances whatsoever.
We are now in the fight of our lives to try and restore it.
That was the start of the coup.Its just the majority of the population doesn’t realise it
They’ll find headless restaurant inspectors behind hedges …
UK Column News did a full report on this. Worth checking out on YouTube.
Funnily enough, RT has been reporting on this. Strange that we have to rely on that dictatorial and repressive country to find out what’s going on here in Blighty.
Zarah Sultana made a great speech about that while all the other MPs were sleeping
https://hansard.parliament.uk/Commons/2020-10-05/debates/DF29B1ED-6BB3-414A-A65E-53CD4BAB694A/CovertHumanIntelligenceSources(CriminalConduct)Bill#contribution-05693CE1-CEC2-4245-AA8D-77052FBBB9B0
Be nice if she raised her voice, or voted, against the covid lockdown bollocks.
Shame these people who claim to oppose authoritarianism are so often determined to conflate properly enforcing immigration laws with those issues. Sometimes stupidity on their part, but more often I think because they are ideologically opposed to border controls.
Most “asylum seekers” are economic migrants. Basically, if they aren’t relieved to get to a safe British camp on Ascension Island while their case is heard then they aren’t really asylum seekers.
Given that selective choice of targets and the fact that this particular Labour MP this morning tweeted that New Zealand are the example we should be following, it’s pretty clear she’s another lying hypocrite on authoritarianism, who loves it when her side are doing it but pretends to oppose it when she thinks it’s politically useful to do so.
Is anyone on here behind the Young People Against Lockdown account on Twitter? Good stuff if so!
I wasn’t aware of that but what a relief! Young folks fighting back, hallelujah! Thanks.
No, but please paste the link
https://twitter.com/YoungPALD they are looking for volunteers – I might set up a Twitter account and get involved.
Advice you already know. Twitter is toxic it lures the unwary in. Genuinely treat with caution.
https://sciencebasedmedicine.org/great-barrington-declaration/
As an attempted takedown of the GBD, this is pants
It raises straw men that are unconnected (climate change denial etc.) and complains not everyone that signed it is real
The only real argument of substance is that herd immunity without a vaccine is impossible because of reinfection – for which there is almost no evidence
TLDR
The only real argument of substance is that herd immunity without a vaccine is impossible because of reinfection – for which there is almost no evidence
I am happy that it is possible to have, or acquire, a ‘resistance’ to the virus that is not the same as full immunity. And that this level of resistance is enough to create a practical, workable ‘community immunity’ where the virus more-or-less disappears. For sure, if a heavily-infected person sneezed in your face, you might become ill. But that wouldn’t invalidate the general suppression of the virus on average.
This is the grown-up, adult view of immunity and infection. It accepts that full immunity is probably not even possible (like the flu), but that it’ll be OK, anyway – just as we have lived with flu and other infectious diseases around us all our lives. It’s a trade-off between absolutely safety and a worthwhile existence.
For the life of me, I can’t understand why supposedly intelligent people don’t get it.
Made me chuckle
https://twitter.com/_Sigel/status/1316331510711169025/photo/2
This one:
Whoever posted the link to the Model Health Show video, ‘Mask Facts’ a day or two ago, thanks. Just finished watching it. One of the best programmes I’ve seen during all this. Most informative, and a beacon of common sense as we pass through a very dark night.
https://themodelhealthshow.com/maskfacts/
Thanks, will check it out now.
I get some abuse when I put any anti-mask stuff on FB but will keep putting up links like this.
Staggers me that people want to live on the set of the handmaids tale.
Same here! I am an introvert with 2 very young children so its not like I socialised or went shopping, eating out etc much anyway and my job is funded until Dec 20201(unlikely after that), my husband pointed out that this whole Corona saga doesn’t really affect us that much directly BUT to me it does in many other ways. I have a horrible feeling about where this is all going and what my children are growing up in. Thankfully at 18 months and 2.5 years old they dont know any different. I want to oppose all of this for their future and everyone elses. I feel so bad for all those losing their jobs and mental health, cancer patients etc being impacted. I think us lockdown sceptics are the ones who truly have a heart and soul (instead of being branded Granny killers).
Yes – i completely agree – my hatred of the masks in particular is visceral. I cannot explain how it feels to someone who doesn’t feel the same. The sadness is bottomless.
Huge hatred of masks here too.
I bet I hate muzzles more than you both put together … I defy anyone to hate muzzles more than I do …
Well you did start this thread – so ok you win!
They absolutely disgust me, make me feel sick. Revolt me, make me feel ill and hate the human race for being so stupid as to wear them.
Back when they first came in on the buses, I was driving past one containing a few muzzle-wearers with my 4-year-old in the car and muttered instinctively under my breath … and she said, ‘Daddy, why did you say “dirty and disgusting”‘.
My goodness you really do! Yes – my sentiments exactly. I have a bout of tourets when I see people wearing them alone in their cars or walking down the street (my kids are much older and used to their potty mouthed mother now). Those propaganda radio ads have the same effect actually. My language is definitely more colourful these days.
Me too. If an advert comes on with someone wearing a mask I turn over. In fact I turn over if I see social distancing. It is an outrage to my soul and will never, ever be normalised.
I hate the beer one which shows people in a pub enjoying themselves, and then in text next to it apologises for showing these disturbing images, making it clear that this was shot ‘pre-covid’ and that people must ‘socialise responsibly’. It actually makes my stomach turn.
I can’t stand even to look at someone in a muzzle. And if I see a picture or video with muzzle wearers I have to skip past it or turn my head away.
But all of that pales when I see images of children wearing the accursed vile things …
They make 4 year olds wear them in the USA to pre school. I see that as child abuse.
an outrage to my soul
Yes, that touches on it. Every sense, conscious and unconscious, screams at me that it’s just wrong, evil even.
Well I do, more than mere words can describe.
I’m just surprised we haven’t seen a massive crime wave, are criminals just as wet as the general populace?
Can you describe the attacker/robber sir? No he was wearing a mask.
I suppose balaclava will be perfectly acceptable as a face covering, stockings?
I think perhaps I do? or maybe my 6 year old does? she had a dream last night of the masked ones against the good ones (no masks). the good ‘winned’. let’s hope her dream comes true.
Me. I get a very physical reaction to seeing people in them. Angry, upset, hyper ventilating, shaking with rage and adrenalin.
I nearly got attacked by a big bloke in one at the start of this in March.
I went out to another town on the first day we were allowed to drive again after lockdown. I got talking to the cashier guy, he was a sceptic, it really gave me a boost and I thought that all I had to do was talk to people about this madness, spread the word that its all bollocks and it would be over soon.
As I left the shop another guy was walking in and I said “hey mate what’s with the facemask?” He immediately went ballistic,
“How dare you! I have been wearing this for the last 3 months, my son has cistic fibrosis. How dare you!” etc, He stank of Skunk, I stepped back away from him out of swinging range apologising, getting ready for incoming punches. I managed to get away from him but I felt like such a Charlie.
However being up close to his angry crazy masked face was very upsetting for me. Very traumatic.
Perhaps this is why I have such a problem with them.
My two are 4 and 2, and we pretty well keep it from them – although with places shut, closed playgroups and everyone wearing muzzles it’s difficult at times.
Like you, I find it horrible to think where this is going. Even if it doesn’t go anywhere I will never view my fellow countrymen in the same light again.
And likewise, the corona garbage hasn’t directly affected our family that much. Doesn’t mean I’m not fuming with anger about it though.
BRILLIANT COMPARISON.
See the tory shysters are backtracking on decriminalizing the non payment of the the bbc licence fee.
They should be abolishing the television tax.
Doesn’t surprise me. Who knows what goes on behind the scenes.
Reward for being an excellent propaganda outlet for the gov’t
Probably, but the “Conservative” hierarchy are being dishonest and shortsighted as usual. Of course the BC institutionally hates both conservatives and the “Conservative” Party, and that will never change in our lifetimes, because you’d have to replace the managerial, editorial and journalistic staff wholesale to achieve that.
They might have operated a truce while the government is pushing the authoritarian collectivist agenda they like, but it won’t last two minutes after that situation finishes.
Why would they when the BBC have been magnificent for them.
So why isn’t there a second wave of death in Sweden then?
Notice how Sweden is rapidly dropping down the list of “deaths per 1M”.
they may only count people who died of covid for definite. we count false positive covid test results of people who die of anything
I’m afraid that I have frightened to death a shopworker today.
We got talking about masks and I cited the German study which had found 82 bacterial infections and 4 types of mold on a mask which had been worn all day by a child. I also told her what had been said about the uselessness of masks by the CMO and the deputy CMOs. The poor woman was horrified, especially as another customer in the shop was nodding vigorously in agreement with me.
Excellent work. This is an unexpectedly positive reaction. Nothing to be afraid of at all.
Bill Gates and his (very manly looking) wife, Wanksock, Whitless and Unblanced will beat the sun by 3.999999999999 billion years.
You should of said that the earth will be underwater in seven years time and all the polar bears will die of starvation as they float of on little melting ice bergs and starve to death. That’s what they tell them at school.
In this new normal where we are all required to sacrifice for the public good, why haven’t we nationalised Big Pharma?
The new normal means annihilating all public life in order to save it.
Have you signed this yet?
“Nullify non-disclosure agreements/gagging orders for NHS staff for covid-19”, on the basis that we’re not being told the truth about what’s really happening in NHS hospitals. It needs 10,000 signatures to prompt a government response, and 100,000 signatures means that there will be a parliamentary debate.
https://petition.parliament.uk/petitions/550598
There are 5,000 people in hospital who have tested +ve for covid
How many people are normally in hospital for anything? Is there an available stat on that?
Considering they are testing everyone in hospital isn’t it just false positives from people with broken legs etc?
Typical bed occupancy for NHS England I think is about 110,000.
During peak covid in April, the NAO reported:
“Between 17 March and 12 April, the number of available beds increased from 12,600 to 53,700, while the proportion of these beds occupied by a COVID-19 patient peaked at 29%. The proportion of critical care beds occupied by COVID-19 patients in England was highest between 5 April and 14 April, at 50% or just over”
Is that what they call ‘overrun’, then?
I recently heard it described as ‘catastrophic’.
BobT posted a graph of the numbers here yesterday, basically occupancy normally stayed at around 110,000, then plunged in March to around 50,000 as the NHS cleared the decks.
Around 60,000 patients were turfed out or excluded to make space for these less than 20,000 covid patients, which is why while some parts of the NHS were undoubtedly busy, large parts were twiddling their thumbs and making tik-tok videos. Many of those sent home, as we know here, went to care homes carrying covid, contributing to the scandal of mass deaths caused there by the panic response, recently raised by Amnesty International.
They’ll never tell us that.
With a very high degree of probability there is no virus.
LS’ coverage of 5G EMF radiation poison is inadequate and often negative.
A) Most fatalities of the elderly in Italy had been vaccinated. What is the % in Britain and America?
B) Lockdowns in America have been blamed for a sharp reduction in infant mortality and autism, credited to a reduction in vaccinations.
C) The body’s response to 5G EMF radiation poisoning produces symptoms that are credited to a virus.
D) COVID hotspots are 5G roll-out zones.
http://radiationdangers.com
E) Radiation in the frequencies used by 5G is killing Amazon trees and insects due to the US’ extensive radar coverage to stymy smuggling.
To kill a bee hive, put a cell phone in it for 30 minutes twice a week. 2 weeks, gone.
F) Jon Rapport has done extensive research and uncovered much evidence to support his contention harmful viruses are a myth. The measles virus was proven a false hypothesis in German court.
http://nomorefakenews.com
G) Images claimed to be a virus are of an exosome. Exosomes have functions in protecting the body and repairing damage. Vaccines that interefere in the process weaken the individual to other insults to the body.
H) Vaccines are not tested enough to merit certification. R. Steele reported:
Rebecca Campbell: US Government Loses Vaccine Lawsuit — Has Lied to the Public for Decades — Vaccines NOT Tested — Autism Will Drop If Parents Use This Case to Legally Challenge Mandated Vaccinations
https://phibetaiota.net/2018/09/rebecca-campbell-us-government-loses-vaccine-lawsuit-has-lied-to-the-public-for-decades-vaccines-not-tested-autism-will-drop-if-parents-use-this-case-to-legally-challenge-mandated-vaccinatio/
WHO has done a U turn on lockdowns, Perhaps some Liverpool lads had a word with them, or perhaps the mountain of pending litigation that I believe includes manslaughter charges persuaded them. How long before masks are admitted to be dangerous especially in combination with 5G causing O2 starvation by changing the molecules and damaging haemoglobin as well as depleting O2 in the air.
What’s it all about?
Pope Francis says New World Order needs to happen now with United Nations in charge
https://clothcap.livejournal.com/302964.html
FKTV: “Globalist Takeover from Within”
https://forbiddenknowledgetv.net/usa-takeover-from-within/
Enough for now.
hello Clothca,. Thank you for all the links
Latest figures https://news.sky.com/story/coronavirus-uk-reports-another-137-deaths-and-19-724-cases-12104039 . Usual caveats death with/from and cases aren’t always cases.
Krankie’s reporting 15.
I reckon the next level of the con is here; they’ve started counting flu deaths as Covid-19. The sudden jump is too unbelievable!
She’s promising new rules on face coverings.
I am aghast that this nation is full of so many ignorant, insufferable dimwits.
I blame daytime television.
Funny I’ve been blaming love island, x factor/BGT and made in Chelsea
Same difference.
Turned their brains to mush
You said it.
I used to find job interviews daunting. I wish I had known then what I know now about how cowardly and uncritical thinking most people, regardless of their employment status, are. A nation full of hysterical drama queens completely hypnotised by the BBC and the rest.
Started with Diana’s death and the stomach churning reaction at the time and it’s gone downhill ever since.
Happening here too, but they are painting cycles on the newly surfaced ‘roads’.
Lidl this morning. A handful of unmasked customers among the zombies. This store is in an area with a lot of east Europeans, and in my experience the Poles in particular are often quite “devil-may-care”.
I use the self-checkouts, of which there are 6, but as usual 2 of them weren’t working. While the stroppy woman assistant on duty was dealing with another customer beyond the checkouts, the red lights at the top started flashing, until 3 out of the 4 checkouts were “stuck”. I remembered a line from Dad’s Army about a cheeky boy standing outside Jones the butcher’s shop and shouting “Sainsbury’s!” and I said quite loudly “Let’s all go to Aldi!”
Don’t know if she heard me, but the stroppy assistant seems to have mellowed a bit and no longer demands that customers keep their distance from her (she is masked). She came round with her magic key and fixed all the troublesome checkouts, which seem subject to these frequent minor problems.
Despite all the above it’s still a decent place to shop with no door monitor and no questioning of the unmasked.
I too shop unmasked in a lidl. No problems so far.
Forgot to mention, I carry a black felt-tip marker around with me and was tempted to use it on a board outside a restaurant, something like “Social distancing but still welcoming”, with a picture of a smiling diner and a masked waitress. A big cross, an unsmiley mouth, or a short slogan across the mask is tempting – I may do it when no one is looking. One of our sceptics here does such things, Annie if I remember rightly.
I have also, on occasion indulged in such behaviour.
I rip down Covid notices and stick stickers.
Am thinking of a new sticker to use on shops and cafés with notices shrieking that face nappies are COMPULSORY:
FORTUNATELY, VISITING YOUR POXY ESTABLISHMENT IS NOT COMPULSORY. SO I WON’T. SAY GOODBYE TO MY MONEY.
https://www.youtube.com/watch?v=M8cBaXL3QOI&feature=emb_logo
We’re in w.berks – our pavements are being done as we speak. Mind you they were crumbling and prob havent been done since the 1950s when the houses were built. And lots of other roads and the M4 junction being done too.
Same in north yorks
You folks write so much that I;m having difficulty keeping up, so if this has already been covered I apologise.
Since forever we’ve had an hour free parking in the town car parks, partly subsidised by the local shops. This involves pressing a button on the ticket machine. Longer stays required the insertion of money.
At the start of lockdown the ticket machines were shut down, obviously to stop covid-infested fingers from touching the covid-infested button, and to prevent the council workers from touching the covid-infested money. Probably he was furloughed.
This obviously worked as there were very few cases here*
Back in July or August the machines were switched back on, with notices asking people to use an app called RINGO rather than money.
Last week the machines were upgraded probably at enormous expense. The new machines have an entire keyboard where you have to type in your registration number which is logged on a server. The free time has been reduced to half an hour and the other prices doubled.
Obviously traking and tracing our cars takes priority over catching covids from the keyboard. Plus the keyboard is pretty insensitive so we have to stand in a (socially distanced) queue while everyone fumbles.
At first I couldn’t see the point, after all they can’t tell which shops you went in or if you just walked in the park,or if someone else drove it. Now I suspect this is preparation for the forthcoming second lockdown where everyone over 65 or 60 or even 50 is forced to self isolate. Log your car in and expect a visit from the Police, or the Army.
Is this occurring elsewhere in the country?
*actually I suspect the reason for so few cases here is that many people came down with a very covid-like illness between october and february, peaking in december when I also had it. I felt a bit off, coughed a lot especially at night, and developed pink eye only in one eye which was gone by lunchtime. Some people had it even milder, some had it quite bad but no-one panicked because we didn’t know we were meant to.
I’ve heard the same tale from the west country and other places with low covid “cases”
More like cashless society. And desperate councils raking as much money as they can. I travel around the country quite a lot and use car parks, ringo isint new and also a lot of car parks with other systems have you put in your reg number, for years. Maybe planning on all this for years. Big Brother.
OK so we;re just behind the times here and only now catching up. The only places I know that previously required your reg number long before covid were some pubs, to stop non-customers using their car park.
The joke is you can (still) park at the Co-Op and another car park for free and walk to the shops.
“ I felt a bit off, coughed a lot especially at night, and developed pink eye only in one eye which was gone by lunchtime.”
Was today discussing such recent past ailments with a friend.
We used to call them ‘mild viruses’ – even when some of the effects lasted a few weeks. Unpleasant, but hardly a reason to kill normal life.
Yes and when some of the people with not-covid who had it much worse than me went to the octor that’s exactly what they were told
Have not see similar switching of parking meters here. Parking has had the covid fiddle applied to the extent that independent business has folded through inaccessibilty. They don’t want you in your car.
I drove to London recently and caught the tube in. I couldn’t pay to park my car with cash anymore at the station (have been doing so for many years) and I couldn’t top up my Oyster with cash any more either (again – have done so for years).
We’ve had RINGO where I am for ages. And all the council machines require number plate to be input, sometimes full number sometimes just the 1st 4.
But they still take cash as well.
Seems The White House may be onside
From The NY Times
Not for much longer if Trump loses. He’s very much the lesser of two evils.
Just got to hope Trump wins, or we are doomed
I think he will. Just look at how confident he wouldn’t last time, right up to the actual election night coverage: https://www.youtube.com/watch?v=G87UXIH8Lzo
Steady on, Private Fraser.
Doomed I say
Sorry – but the fact of Trump is actually just another example of how far any concept of a western ‘civilization’ has fallen from any contact with reality.
What amazes me about you is how wrong you are on everything you say. It’s absurd.
It’s a point of view, but a Trump victory IMO is way better for sceptics than a Biden victory and nothing else matters much
We cannot afford to put our faith in any politicians. I agree that Trump seems somewhat more palatable than the Demoncrats, but is definitely not to be trusted.
I despise the man but his instincts have been right on this one from the start. He said the cure would be worse than the disease and he also called for less testing. He finally replaced that cretin Fauci with Dr. Scott Atlas. Of course Trump can turn on a dime, but he may be the lesser of two evils at this point in time.
BBC, and lockdowns, getting slaughtered in the comments. All top comments are deeply cynical. Good signs.
https://www.bbc.co.uk/news/health-54538278
Sounds like the 77th and their ilk will soon be deployed.
How you can even go near the BBC in any form I don’t know but thank you for reporting back from the front lines so we don’t have to.
With the guardian and times they area good source to find out the governments intentions
Fantastic, the BBC has been complicit and they should be put on trial for (almost certainly) causing excess deaths over a 5-year period.
I go there to educate them (response to Achilles below)
Nearly 1200 comments – not seen a pro-narrative one yet.
Can you believe the chart that the BBC has dropped in the middle of that bullshit article?
Total fear porn hockey stick, with some totally made up bollocks about the effect of a circuit breaker, and then they put this under the chart:
“An illustration, not a prediction, of what could happen if the current growth rate continues unchanged, with and without a circuit break.”
According to the ONS, there have been 53,335 deaths-with-positive-test up to week ending 2020-10-02, and the BBC are “illustrating” 1.5 times that number of additional deaths in the next three months.
I’m lost for words. Fuck it, I’m changing camps. This is a conspiracy.
It all makes sense when you put on the tin foil hat
Welcome, the kettle is boiling on the camp fire. Nice cuppa T?
Yeah, go on then. Might as well.
Is it signed Patrick Vallance by any chance?
“Predicted deaths at current transmission rates”. That is to say:
“If the figures we are guessing at right now were correct and were real cases, and if those cases led to actual deaths – which is not a certainty at all, then this is what could happen. But this is unlikely.”
Naah, wouldn’t fit on the graph would it?
Cryptic but sounds interesting.
Some in my former organisation were so deep in the governmental matrix, if you told them something outside they just went quiet, complete does not compute moment.
Common Purpose Sheep.
yup we have new cycle paths popping up all over the place.
There you have it bedwetters are the ones that enjoyed furlough.
Maybe already covered unable to keep up at the moment.
“Poor numerical literacy linked to greater susceptibility to Covid-19 fake news
“Cambridge University study also suggests older people less likely to believe coronavirus misinformation”
https://www.theguardian.com/world/2020/oct/14/poor-numerical-literacy-linked-to-greater-susceptibility-to-covid-19-fake-news
Given what we know msm consider to be factual news, could this be seen as good news that younger people aren’t buying the propaganda? The guardian is ill-equiped to do anything about the problem identified by Cambridge because no one cares what rubbish in mi5 daily. BMG Foundation funded or not.
Not only, but also:
U.S. article:
https://news.gallup.com/opinion/gallup/321698/covid-responses-men-women.aspx
The COVID-19 Responses of Men vs. Women
“First and foremost, throughout the pandemic, women have consistently been more concerned than men about catching COVID-19.
This attitude manifests itself in personal behaviors: In trends since June, women have been more likely than men to report having worn a mask at some point in the past seven days.
Looking at the last two months of data, it is clear that differences between men and women are related to partisanship, but they also transcend it.
The following table shows that Democratic men and Democratic women tend to be relatively similar in their COVID-19-related attitudes and behaviors. It is also the case that the average Democratic man is more cautious with respect to COVID-19 than the average Republican woman.
But there are still clear gender differences that go beyond party. Strong gender differences are observed among Republicans (and independents, not shown here), such that men tend to be less concerned about and less likely to take measures to prevent COVID-19 transmission than women within their same party.”
(See the article for the relevant tables. They’re not included as images, and the text won’t copy over meaningfully.)
Men r bad m kay
The article is typical of the Guardian and their ilk:-
“Overall, higher susceptibility to fake news was associated with lower self-reported compliance with public health guidance for Covid-19, as well as people’s willingness to get vaccinated against the virus and recommend the vaccine to vulnerable family and friends.”
Look at the the pathetic guilt treatment should someone not want to be vaccinated or recommend vaccination. I hate this paper with every fibre in my body!!!
You’d have thought that The Groan would know a lot about ‘fake nooz’, given that it publishes so much.
But Viner – the establishment’s favourite whore – is way past being able to tell truth from fiction. Such concepts are way under her servile pay grade. Her promotion to editor was like putting Shipman in charge of a Care Home.
I actually forgot to mention this. The guardian of all places is now the arbiter of “fake news”.
You have to (well – sort of) laugh at the Groaniad – the bog paper about as far away from numeracy as Pluto is from enlightenment by the Sun.
The modern Groan is so far from truth and proper journalism that even the distinction between the terms’black’ and ‘white’ is far beyond its grasp.
Well it feeds the delusion of 60 odd genders so there is still a long way to go for this rag.
The blatantly egregious article is a very long-winded way to spread misinformation about people who don’t buy into the propaganda. It’s a fantastic example of doublespeak.
It’s somewhat the opposite here, a lot of cynical old folks. Lots of good crack to be had, someone walked out of the door at the butcher;s instead of going out the back door, then said
“Oh Christ I went the wrong way!”
I said “The virus is going to kill you now, it’s been laying in wait. It knows when you use the wrong door or walk on the wrong side of the street or if you’re still in the pub after ten, it’s incredibly intelligent you know”
Much mirth among the other folks in the street
Does Carrie read these pages, KH?
Common Purpose began in 1989. The start of a downward slide in society, taking individualism out and selecting programmed sheep to take over the institutions.
Not going to be easy to unravel 31 years of damage – the entire management structure would probably be Common Purpose.
The same year that Eastern bloc communism finally fell after laying waste to the Warsaw Pact countries for 45 years.
By that time, we’d struggled through a recession with 4 million unemployed. Seen industry and communities smashed, public services run into the ground ready for cheap selloffs and the gap between haves and have-nots dramatically widened. We were ripe for the taking.
I’m guessing that the lady’s T&T details said Carrie S and she left a generous tip
That is lovely to hear.
Took my brain a couple of minutes to work it out!
Nice to hear you do get some good ones.
A two-week circuit breaker at the end of October may halve Covid deaths in the UK between now and the end of the year, says a scientific report.
“may”?
“scientific”?
No – another modeller’s fiction. Not ‘scientific’ – just speculation with using another duff computer program.
Who needs a computer program?
I;m pretty sure I remember Chris Witty, or it may have been one of the other talking heads, saying back in May or June that we were going to have another lockdown in October. It was part of the agenda way back then, no reason for it not to come true.
There’s hardly any bloody deaths. Covid amounts to 1.6% of the daily deaths FFS, which averages around 1640. 600 on average are cancer deaths. These insane people suggesting this haven’t got a clue. After the so-called circuit breaker what happens then? Is the virus just going to pack its bags and fuck off? Of course not, just delaying the inevitable. People who didn’t die during the circuit breaker will just die when its lifted. I give up.
Oh they’ve done that 2 week leccy breaker i’ll be off now…
Or, to put it another way, may not.
Pretty unlikely but amusing that they set a goal of the end of the year. A two week lockdown would delay some deaths by perhaps 6 to 8 weeks so it’s possible a small number of people would make it to January who otherwise would have died in December.
Do not argue defensively with scum. Take the offense. Anyone in support of lockdowns needs to be arrested immediately.
Overall, lockdown deaths account for ~26% of total excess deaths to date – and growing. “Covid mortality” (no such thing) will soon end but lockdown deaths will continue to accrue for years to come.
https://twitter.com/Humble_Analysis/status/1315799672158482434
German study shows 1.3% false positive rate for Coronavirus test. If this is accurate, it indicates that essentially all present cases in Germany are false positive.
https://twitter.com/Humble_Analysis/status/1316254237764939776
Let’s face it. Since May every bit of fear, every policy, every restriction has been based entirely on what could happen, not what is happening. We’d have been better off spending all that money on a laser gun to shoot near earth objects out of the sky.
Its true, the most used word right now is Could
Or eradicating poverty, homelessness, hugely increasing health. The mind boggles.
The difference is that near earth objects are actually a real threat and that laser might have been quite useful one day.
Visited Sports Direct yesterday, needed new walking shoes, as it’s all we’ll have left to do, shortly. Second unmasked visit in recent weeks, and once again, no hassle. Staff muzzled, but friendly. Lad that served me was fine, and had good sceptical chat with lass on till.
That’s the way to do it.
Interesting article on Off Guardian – ‘The Covidian Cult’
https://off-guardian.org/2020/10/13/the-covidian-cult/
I don’t think many on this site would now dispute the cult like status the virus has amongst many in the general public and more frighteningly those with power.
“What we are up against is not a misunderstanding or a rational argument over scientific facts. It is a fanatical ideological movement. A global totalitarian movement … the first of its kind in human history.“
Vaguely trying to understand the number of nhs app downloads. More than 10m is the most frequent figure which came out of Hancock after 6 days from launch.
If it was 12 million would they publish that number? All things considered it feels to me that uptake has stalled.
I see that many of Britains banks prevent staff from using the app at work.
“Lloyds Banking Group , along with rival TSB, are among those advising employees to deactivate the NHS Track & Trace app during office hours, when they are not allowed to keep phones on their person. Some banks ask staff and cashiers to store phones away to prevent leaks of sensitive customer data, although this is not formally required by..”
It is bound to stall/ stop. If you are stupid/ naive enough to download the thing you will have done it on the day it was released. If you aren’t stupid/ naive enough to believe it is a good idea you aren’t going to suddenly change your mind.
Yes. They launched it knowing the adoption curve. They also would have planned for obfuscation from revealing the apps in use. No consistent update about app downloads nor app use converted into successful targeted isolation commandments.
Journalists once woukd have been all over this bread and butter scandal – it’s so obvious I can even pick it apart by adopting a slight squint.
Will they declare at any point with it?
Then that figure tells us a lot. The vast majority of the population don’t believe in it.
Whenever I see a Google ad for it I turn it off and click the box that says “ad was inappropriate”. Not sure exactly what they mean by that but it’s the most disparaging option available.
I keep doing that on FB every time I see an NHS or government post about anything Covid related. Irrelevant is the perfect word for all of it – or should be.
Good idea.
Also, there will be many a virtue signaller who has sleepwalked there way into two or three tests and thought better of the app now.
I’m convinced a lot of people who downloaded it initially to see what all the fuss was about have now deleted it.
France is binning theirs, due to gremlins and low take-up.
Good to know and hear thanks.
I read ages ago that even in one of the South Asian countries, the take-up of their t&t app was only around 15%
I think many people installled it out of curiosity, then promptly uninstalled it.
Mrs 2-6’s care company have told employees not to use the app.
FFS Galway City Council has canceled the Eyre Square Christmas Market … Let’s all just hide under our beds for the rest of eternity because The Covid might get us! WHEN will these people understand that SURVIVING is not LIVING?????!!!!! And WHY can they not understand numbers? I’m at the end of my rope.
You need to wait for the SUPER-VACCINE that Bill Gates & Co. is preparing…
The MAIN GOAL?!
Enjoy “your” LIFE while They allow it!
P*S*E*C = Get that vaccine in your veins yesterday!
If Billy G could he would had already done that!
And I’d say he’s trying to solve the wrong problem anyway.
There isn’t a problem with CO2 in the atmosphere. It’s essential for plants and all life. It’s all an excuse to control people.
CO2 is just the distraction… The SRF & Billionaires just want to reduce the size of the Herd. Since “CO2” bla bla bla is already a slogan that the Herd responds to, They use it, with great efficiency.
Well, with that accuracy if we test everyone in the UK we should get about 7.5 million false positives. That ought to blow a few holes in Handcock’s spreadsheets.
I’d assume he’d be relying upon it.
BEST SOLUTION!
If a SUCCESSFUL JUMP is executed by the sheeple, the SRF & Billionaires guarantee an 100% Lifetime immunity to all viruses and bacteria and fungus.
is this still happening?https://www.standard.co.uk/news/health/coronavirus-test-kits-contaminated-covid-19-a4403021.html
Doesn’t matter at all!
THERE IS NO GOLD STANDARD for the chemical reaction morons STILL DO THIS DAY “think” is a “test”…
BMJ 2020;369:m1808 doi: 10.1136/bmj.m1808 (Published 12 May 2020)
So… Just RELAX and enjoy the CIRCUS.
And don’t get tested!
Of course!
Got bored so got onto the Labour Party website, found the complaints page and put in a complaint against Kier Starmer, all MPs who abstained from voting and all local councillors who want more lockdowns.
The charge:
Holding us all in complicit in genocide against the old and sick in acre homes (sent them the Amnesty report link, told them all their MPs and councillors should read it and check if they can morally agree with the actions they are complicit in, contempt of the people and Parliament, bring Parliament into disrepute, possible treason.
When they asked “what makes you think the person is a member of the `Labour Party I put “He frequently appears on TV and in MSM claiming to be the Leader of the Opposition.”
The Conservatives have a shorter form so just asked them to give every MP and councillor the Amnesty report to read.
They don’t care! They are IMMUNE to political responsibility…
I know but killed 5 mins and vented some vitriol.
You never know, sometime in the far future when they look back and research what happened they may say “look, this guy awkward really put the boot in, pity more didn’t do that”.
Wife won’t let me out to do violence against these arseholes (she’s the sensible one) so doing what I’m good at – writing letters and complaints and being awkward.
That’s what They (SRF&Billionaires&jesters) are counting on… Mere internet venting!
What are you doing?
Educating ignorants! Not easy!
And you are so brilliant at it.
You’re certainly good at that.
Amount of roadworks here in Wales is staggering. I suspect Boris bunged them a load of dosh to support mask wearing.
Using a virus prevalence of 0.23% (as per ONS figures for percentage of positive tests in England over the past six weeks), I calculate that a saliva test with an 87.5% accuracy would result in 98.2% false positives.
Apparently there was no panic buying in March. Those empty shelves were a figment of your imagination:
https://www.thegrocer.co.uk/the-grocer-blog-daily-bread/panic-buying-didnt-happen-efra-report-shows-government-rewriting-history/649338.article?fbclid=IwAR3maTscI4ym2e8ZO9ffe_zKvLCLS-vcAeiX4eR8qMGeYVcufMwBL5nZD_A
“Who controls the past controls the future: who controls the present controls the past.”
“that is truly Trumpian in its blurring of the facts and denial of wrongdoing”
Whoever wrote that clearly hasn’t been paying attention to the antics of the Democrats and legacy media.
Wow, they really are living in dreamland if they can deny that
They’ll be telling us next that freezers are back in stock…
Oh dear. Our excitable neighbour has been round to collect a parcel. It seems someone has got IT in the next street. We are of course now terrified and repentant, we will wear masks even in bed and apologise to everyone we have pissed off by spreading disinformation, denial and scepticism about The Plague. We may have to stop posting on this site and sign up with Arsebook and Twatter to get The Truth.
Actually, she was remarkably relaxed about it considering her elderly parents live close to the hot-spot epi-centre and, like us, thinks it’s probably just someone with a dubious positive test. She also told us that her father-in-law helps out at an undertakers. Apparently there is not much work at the moment (!) and that he has said it’s true that just about anyone and everyone has ‘Covid’ on their death certificate, irrespective of true cause of death. Also she is disgusted that her brother-in-law has downloaded the dodgy app and we beefed her up with some info for him about the data-trading.
p.s. https://www.dutchnews.nl/news/2020/10/the-netherlands-goes-into-partial-lockdown-face-masks-will-be-compulsory/ More incompetence, no doubt
MW
Damn, you made me wet my keyboard, MW.
Three people have died in my street, NOT from covid, just from old age (but I wonder of they had anything that went undiagnosed or untreated). Happens all the time, lots of old folks around and it’s what they do
Anger building in Liverpool
https://twitter.com/REWearmouth/status/1316412328968097793
Pub renames itself ‘The Three Bellends’ in protest against Liverpool lockdown
A major issue is the reliability of PCR tests. A criticism of the PCR tests is that it doesn’t distinguish between Covid 19 and other viruses whilst defenders of PCR argue this is not the case. I would like opinions on this as to whether there is firm evidence to support either view.
Firm evidence? It’s not even up for debate is it?
https://www.medrxiv.org/content/10.1101/2020.08.04.20167932v4
We know it can pick of fragments of viral material, even other coronaviruses. There is no real debate about using PCR, its about the cycle thresholds that are applied, the subsequent definition of an ‘infection’ and its suitability for mass screening of a population to detect the spread of a virus.
It’s got its place, but as this entire omnishambles rests on use of RT-PCR, we are almost looking at criminality given the costs to livelihoods and the failure to disclose vital information regarding how accurate these tests actually are.
That paper you cited doesn’t say anything about fragments of viral material from other coronaviruses that I can see.
These are the actual fragments the tests look for:
ATGAGCTTAGTCCTGTTG
CTCCCTTTGTTGTGTTGT
AGATGTCTTGTGCTGCCGGTA
GGTAACTGGTATGATTTCG
CTGGTCAAGGTTAATATAGG
TCATACAAACCACGCCAGG
ACAGGTACGTTAATAGTTAATAGCGT
ATATTGCAGCAGTACGCACACA
ACACTAGCCATCCTTACTGCGCTTCG
One of those is found in both SARS1 and SARS2. The others are all unique to SARS2 out of all known viruses that infect humans.
Yes they are all very short fragments (the complete genome for SARS2 is about 30,000 of those letters). But they don’t come from anywhere else except the SARS2 virus (well actually one of them does exist in the human genome, but you’d be unlikely to find that).
So if you found them there is or was SARS2 in whatever you’re looking at.
I think this one should have been:
ACAGGTACGTTACTAGTTAGTAGCGT
GATTACA
Abacab
CAS 1074
KAR120C
Vague one that, I know…
You’re not a number, then, Nick?
Glad someone knows it!
That takes me back
That’s the beauty of this site. We go from genetics to Genesis, while they are Selling England By The Pound and we end up Prisoners.
All human life is there!
“cross-reactions with other viruses or genetic material could also be responsible for false-positive results.”
https://www.thelancet.com/journals/lanres/article/PIIS2213-2600(20)30453-7/fulltext#%20
“could”. Then if you follow the reference they give for that claim, it’s this (government!) document:
https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/895843S0519_Impact_of_false_positives_and_
negatives.pdf
Where they say, “False positives were observed unexpectedly in norovirus assays in patients with enterocolitis, due to unusually high levels of human DNA in samples”
Which may be true, but has nothing to do with SARS2 PCR tests.
Other viruses are not a source of false positives. I’ve seen this claimed a few times, investigated further, and the claims never hold water.
One of the very early PCR tests could false positive on SARS1 (but not on any other coronavirus). But so what, SARS1 is worse than SARS2 anyway.
Then there was a document from the CDC saying that being positive for SARS2 did not rule out superinfection with another pathogen that was causing the symptoms. This is of course true but the unfortunate way they worded it made it sound like they were saying the other pathogen could cause a false positive.
Often when labs are evaluated for their PCR test they send them controls which contains other coronaviruses. I’ve never seen a case where any particular lab had a higher false positive rate on the other coronaviruses than on the samples that didn’t contain any virus at all. But sometimes the total number of tests in the study randomly ends up having slightly more false positives on the other-HCoV samples and then this gets cited as evidence.
Sometimes there is some confusion as well with antibody tests, which can certainly false-positive because of other viruses.
It would be very unlikely for PCR to react with other viruses as it faithfully only amplifies the genes it’s looking for. If it didn’t do that the whole process wouldn’t work– and we use PCR for lots of things and have done for many years, not just for tests for viruses.
The PCR test is a very good test if the cycle threshold is kept reasonable, and nobody should use any test who doesn’t understand Bayes Theorem. Unfortunately the government are a long way short of understanding even basic maths.
Absolutely. A quick course in Bayesian Probability Theory could save us all. Half day is plenty if you have A Level maths.
“There is no such thing as herd immunity.” Nadine Dorries.
Flu symptoms are the body’s defence reponse to intoxication. A heavy night out produces flu symptoms next day.
Body defences include exosomes. Exosomes can convey toxin information between people that are in close contact with each other. Exosomes have a short existence of at most a few hours. Exosomes are inert and don’t reproduce. Those that haven’t been intoxicated by, e.g. 5G radiation poisoning, but exposed to someone having a defence response to it will develop a defence response and suffer less when afflicted.
Babies don’t have a developed defence system so don’t have a defence response (that includes pneumonia). Those whose defences haven’t been compromised. that are not ill, not elderly, not living in dense, toxic pollution (Wuhan, Lombardy) either don’t get ill from e.g. 5G radiation poisoning or suffer very mild defence response symptoms.
I managed all that without typing “immune” once.
The measles virus was eliminated by a German court. A gent thought he’d won a large sum on offer for proof of the existence of the virus. It went to court. He didn’t collect. Anna Von Reitz offered $5 billion dollars for proof that a harmful and infectious virus was causing what is credited to SARS COV2 coronavirus infectious disease 19. It’s there for the taking.
I say all this as a non expert and am happy to be found in error, but I doubt that is possible as I’m nearly always right, because I pay attention to those experts that prove to be neither jobsworths nor in Gates’ pocket, nor seeking political advantage.
The woowoo $WHO$ has done a U on lockdowns can someone tell that prat among prats, halfwit Hancock, and the Fascist military mutt that told us we must not look people in the eye. Labour woke up too late to profit. Lockdowns are dead in the water. Everyone around here is ignoring them and waking up to regime duplicity. I expect there will be court cases over harmful, compulsory masking that avoids transfer of exosomes when having sex. And authoritarian Nazi Jew, Boris’ illegal compulsory or compelled lockdowns.
Is Gates running the regime Nadine? Or is it the UN?
Good God, what does she think vaccines traditionally do?
Nadine is thicker than mince
Great Barrington Declaration co-author:
Dr Jay Bhattacharya, co-author of the Great Barrington Declaration: “The current lockdown strategy seeks herd immunity. That is the end point. The question is how much death and suffering will there be in the meantime?”
By the way there is appalling clip of Hancock dismissing the Great Barrington Declaration
14 Oct 2020
https://www.youtube.com/watch?v=ivVuUqLDqAk
Can’t watch that utter, rhymes with Hunt. And he’s another one (Jeremy) spouting off yesterday about a rethink after two weeks of tiered Hell, and I don’t think he meant a relaxation. Double down, and if that doesn’t work double down again!
Does anybody else have the problem on YouTube, especially with talk radio clips, that the ads come every minute or so and then it decides to move onto the next video well before the end?
Does anyone have the link please to the German mask video which showed the 80+ bacteria etc? I’m struggling to find it now.
Thanks in advance.
I don’t have that, but I do have a segment on masks that Tucker Carlson did on last night’s show:
https://m.youtube.com/watch?v=b55a1vb8csQ
Tucker Carlson segment on masks
Thank you!
I have some doubts about this one… we are all covered in bacteria inside and out. We wouldn’t survive without them. I don’t care how many bacteria species/colonies are present on my toilet seat or kitchen surfaces. Just whether or not they’re capable of causing disease.
Protest Saturday, St George’s Hall, Liverpool, 1PM
Also one in Central London on the 24th.
See Save Our Rights UK
What’s happening in London on the 17th? Seen no further details :o((
And where in central London on 24th? Or TBC?
tbc
Bet that will not be on MSM
I expect not, unless it’s “Covid deniers gather in Liverpool”
https://www.spiked-online.com/2020/10/13/the-pub-industry-is-on-the-verge-of-collapse/
Interesting article Toby has put up regards the pub industry. Highlights that masks and 10pm curfew have hammered there takings.
As much as I don’t want to see businesses go under us anti-maskers need to vote with our feet. Just don’t play by their rules.
Why on earth would anybody want to go to a pub pay £5 for a pint and sit down in a PPE face nappy tracked and traced HELL zone with no music and no company and no possibility of talking to anybody.
Went to my local on Dartmoor today to have a drink with a friend. Staff wore clear visors. No track and trace or QR codes, tables spaced normally, all occupied. Roaring log fire and a couple pints of Jail Ale. Very pleasant. Relaxed staff and owner. But then this is rural Devon!
Sadly, my previously sceptic and sensible landlord has succumbed to the mask on mask off nonsense so I will be curtailing my visits.
The visors put me off, particularly the visors, even more idiotic than face nappies.
Agree on the hell zone, but shit show or not, I wouldn’t be paying £5 a pint anywhere.
Freedom of movement within Germany has been stopped through indirect means.
https://youtu.be/ZJjdMJ_JUrg
Red Pill Germany YT channel was mentioned today on UKC as having some very interesting videos. This is one.
All that it takes for evil to flourish is for the good men and women posting on this site to keep complaining about the nonsensical narrative oozing out of all public officials and their advisors all over the world.
In my humble opinion it is the refusal of such good men and women to step off the cliff that separates those that have a deep seated faith in the establishment to look after them and listen to reason ( One more bit of statistical analysis is bound to make them
see sense, Clementine.) from those who know that they ( public officials and their myriad advisors ) are all either fundamentally stupid or fundamentally insane or fundamentally criminal in their intentions.
No one is going to come and save us from this evil. I am coming to the conclusion that there is virtually no one left in public office or public administration who is not utterly corrupt or utterly befuddled by years of indoctrination in what passes for our education system. There are plenty of sensible people in the world but we have been too busy working, playing and in my case raising children to notice that our entire society is pretty much fucked. It is all our fault. So many of us have been so complacent for so long.
Rant over. I go from hysterical to angry to desperate in ever decreasing circles.
We probably all feel the same to varying degrees.
People will act when they have nothing left to lose.
The frustration is crushing, we can defy the rules, ignore the fines, or fight them, but the system is stacked against us when we act alone.
I think things will change when furlough ends and we have around 6 million people without jobs, and many with no income. A fine is meaningless when you have no money! Prison will create martyrs, and the tide will turn.
In Argentina they used the Atlantic as their prison. But that would never happen here!
I have never been complacent about how the normies are brainwashed and I have fought against it for my entire life.
To step off what cliff, James? And – preempting your answer – what difference would it make if we all stepped off that cliff?
Hi Matt,
Sorry, I missed your comment. The cliff in question is the one which divides the uplands, where we all believe that we are governed by people just like us-basically good, possibly a bit more ambitious and definitely at the moment a lot more incompetent and the lowlands- where we learn that the people who attempt to run our lives are corrupt, possibly psychopathic and definitely do not have goodwill towards their fellow human beings. It is the difference between believing that we can use democratic means including a judicial system to bring this madness to an end and the awful realisation that nothing will
change until we actually stop them from destroying our society. It is the difference between being ( in moral terms) naive children and being responsible adults.
In answer to your second question the difference would be a lot more gym owners in Liverpool defying authority and mass demonstrations across the land led by people who have the sense to understand what is going on and the courage to do something about it.
TOTAL RESPECT TO THE GYM OWNER WHO REMAINED OPEN IN LIVERPOOL AND ESPECIALLY THE RAVERS AT CHUCKING OUT TIME.
Top lad. He’s almost made his £10K on go fund me already: https://uk.gofundme.com/f/save-liverpool-gyms
Does he have to pay all the incremental fines or just the £10K one? Can they fine him this every day? Not sure how the police can do this as I’m not sure it’s a law?
He mentioned covering legal fees, so he probably intends to fight any fines in court. Chipped in £5 myself. Hope anyone who can afford it supports people like him. We need more lawsuits against the government.
That’s been going on for quite a long time – way before the Covid crap.
LAs were supposedly hard up, but Amey and other offenders were raking it in – digging up roads, felling trees (see ‘Sheffield’) etc.
The expenditure has been observably mountainous – straight out of taxation into the private purse, in tune with the pipeline established over the period of ‘freemarket neoliberalism’ – aka subsidy from taxation (cut out the middleman, and substitute a ever-lasting contract).
Also in line with Agenda 21/30.
Forgot to mention, “7 million new cases,” unsurprising when they are testing for human chromosome 8 sequence. The test works by amplification, diferent levels in different stations otherwise the headline would be 100% test positive for COVID – uh, I mean human chromosome 8.
It’s a confidence trick. Wanna buy a bridge?
The Bodj (board of directors Jew) occupation regime, possibly a UN service corporation (EU membership was a corporation takeover) like the 2 US occupation regime corporations, needs to be frog marched to jail.
Speaking of which, I haven’t seen guy153 in a while.
Still here
I did actually see this comment but didn’t bother to reply although I did downvote it.
It’s true that one of the genes in the SARS2 PCR tests also appears in the human genome. But I think it’s unlikely it would cause many false positives because that gene (I don’t know what it’s for) would have to be being actually transcribed into RNA at the time you did the test. Also most of the tests look for more than one SARS2 gene. And the false positive rate isn’t that high.
It’s also true that with a lot of amplification you will be more likely get a false positive, but I don’t think that’s because of the human gene. You can just as easily get a false positive on a papaya with a high cycle threshold.
Health Secretary and Health minister denying basic reality in respect of herd immunity.
The equivalent of putting flat earthers in charge of a space program.
The entire political class is out of touch. All laid bare to our gaze now.
Joe Biden: “We choose truth over facts!”
We’re witnessing the death of science and the Age of Reason
Who knows if it will come back in any of our lifetimes
It will come back eventually because it delivers the goods
Good analogy. It’s a culture war and science is on the frontline
Further to the comments about ten minutes ago regarding the OffGuardian ewarticle about the Cult of Covid (I’m tempted to spell “Cult” slightly differently), here’s Dave Cullen from Ireland, talking about the same thing:
https://m.youtube.com/watch?v=2gkUJk4dvaM
This is a Spiritual Battle
It’s an hour long video, and I haven’t yet watched it all.
Another video on the Global Reset:
https://m.youtube.com/watch?v=tInLlsPdZO0
The Great Reset and The Man Behind the Curtain
https://joebiden.com/build-back-better/#
BUILD BACK BETTER: JOE BIDEN’S JOBS AND ECONOMIC RECOVERY PLAN FOR WORKING FAMILIES
“As the world begins planning for a post-pandemic recovery, the United Nations is calling on Governments to seize the opportunity to “build back better” by creating more sustainable, resilient and inclusive societies.
“The current crisis is an unprecedented wake-up call,” said Secretary-General António Guterres in his International Mother Earth Day message. “We need to turn the recovery into a real opportunity to do things right for the future.”
https://mises.org/wire/build-back-better-why-are-both-biden-and-boris-now-using-phrase
The WEF has been using Building Back Better for a long time
They are confident enough to step out behind the curtain now
Let them. Analysis of what they propose will expose all the weaknesses of their argument.
Spocks Beard:
I’m the man behind the curtain
The one who pulls the strings
Got my finger on the button
But my mind’s on other things
I’m the most impressive person
No one’s ever really seen, oh
In the shadow of the spotlight
Always waiting in the wings
I’m ready for my close up
When the fat lady sings
I don’t know if you can hear me
But you’d better hear me out
I manipulate the matrix
I know how it all turns out
I’m The Man Behind The Curtain, oh
Pay no attention to
The Man Behind The Curtain, oh
And I know how it all turns out
My little white lies
Are all getting colored in
My impromptu alibis
Well, they’re wearing mighty thin
Though you don’t walk away with anything
You didn’t carry in
I deliver dispensation
For most any random sin
I’m The Man Behind The Curtain, oh
Pay no attention to
The Man Behind The Curtain, oh
And I know how it all turns out
And when the curtain gets pulled away
Guess there’s always a piper to pay
You caught me out
In my base deception
I was only trying to make
The wrong impression
On the punters, punks and drunkards
That fortune floats my way
And the curtain gets pulled away
I’m The Man Behind The Curtain, oh
Pay no attention to
The Man Behind The Curtain, oh
I know how it all turns out
I’m The Man Behind The Curtain, oh
Pay no attention to
The Man Behind The Curtain, oh
I know how it all turns out
The man, the man, the man, the man, the man
I know how it all turns out
And when the curtain finally comes down
The puppets all slump to the ground
The doves lie silent in their covered cages
And though the mezzanines are still echoing
With the rock of ages
The circus has moved on to another town
And the curtain finally comes down…
I believe that the plague was more or less finally eradicated by the great fire of London, but I don’t want to give this rabble any ideas.
At this point I’d almost welcome it. At least it would be a fairly swift end rather than death of a thousand lockdowns.
Hopefully the new fire will start in the houses of parliament.
Do you mean to say that the Armada wasn’t Spanish?,
Oh no! The spymaster was probably called “Gates” or “Schwab”.
“Kids are now taught…” is not a good way to begin anything
The Great Fire of the Palace of Westminster might end Corona. Especially if all the MPs and Lords are locked inside when it happens.
Thank you.
as soon as this pub is open, I’m going for a drink. It’s a 4 hour drive but worth it! https://www.huffingtonpost.co.uk/entry/liverpool-pub-three-bellends-lockdown_uk_5f871a9cc5b6f53fff07b701?fbclid=IwAR1errvdWSR-L8QwW_N-Fq8-T9PVgAqXdjP6zW_JfYalTfRYGzdkADLLlZs
Hancock slagging off the GB Declaration reminds me of Brexit and John Bercow. Bercow wasn’t supposed to take sides, but towards the end he knew that we knew he was partisan, and so he was happy to reveal his biases on Twitter, in interviews and even in the Commons (he even joked about it). The whole Commons knew the situation, so his supposed neutrality was just a pantomime. He was set up as the enabler for one set of MPs and the enemy of another.
I am pretty sure that Hancock is not supposed to take sides on this issue, either. But in his statements, he has done so. He has closed off the possibility of our government pretending to having an open mind on the matter. It is now impossible for them to change track. The government is now the affirmed enemy of one set of MPs (and people) and the friend of another. Everyone knows the situation, now, but a charade of “following the science” will be maintained, anyway.
There’s no wiggle room for Hancock at least, and probably not for Johnson. They are not going to change tack, so if things are to improve it will need them to be ousted by a Tory backbench revolt. That’s the only plausible scenario. Labour will not help us.
Give the Breckshit a rest.
its a valid comparison . just because you dont like Brexit doesnt mean that it is wrong to mention it in context .
F*** off you c**t.
Is it possible that Brits believe pollsters are tapping their phones ?
Actually making a cold call for a “pole” or “Survey” is a standard tatic of just about any investigative agency, eg benefit fraud people, the cops, the job centre private investigators.
They pretend that they are doing market research and ask a few questions about posh cars and holiday arrangements your shopping habits then they ask you about your living arrangements and try to see if, for example you could be co-habiting and claiming benefit illegally.
I guess a lot of the people now might be quite reticent about answering questions put to them by a stranger but the ones that aren’t are going to be almost certainly in the cult of covid and will hapilly answers questions put to them by somebody doing a survey
https://www.removethetorygovernment.org
End of TV weather forecast:” Getting wetter and windier”
No, I must have got that wrong, it’s got to be about the government.
Another parliamentary debate about Contact Tracing, we hadnt even heard about it this time last year now they are yacking on as if our lives depend on it. The whole of Parliament has lost the plot
I’m almost praying for the whole system to be hacked
TBF to Sky, Anneliese Dodds is getting a bit of shit over how this plan of another lockdown will actually play out, the cost and impact. Is the illusion finally starting to break for some of the news presenters as well? It might be wishful thinking, but I’m starting to slightly pick up that more people by the day are feeling a need to question this lunacy.
I wish it to be true. Mark Dolan is the strongest ally
Hope so. Once the news editors are on side, it’s game over.
I’ve been thinking the last week or so, eventually some of them have to start breaking. They have kids and families this is affecting as well. They must be looking at Christmas and thinking what about those great piss ups and dinners we had every year on the company expenses, guess we won’t be having those this year…
There won’t be any venues left for them to go to anyway.
Exactly. And when they bother to actually look at the numbers (assuming they haven’t already), they’ll realise. Those who look at the numbers always realise…
Latest tweet:
@BorisJohnson
@MattHancock
You tried lockdown. Didn’t work.
You tried masks. They haven’t worked.
You’re trying curfews and traffic lights. Looks like they’re not working.
Two options left, boys.
Let it rip.
Herd immunity.
Your call.
#KBF #ENDLOCKDOWNNOW
There is only one option as far as the Corona Cretins are concerned.
More lockdown.
If it doesn’t work, it’s because naughty human beings are not following the rules. The world must be made safe for zombies by eliminating human beings.
They can try.
Guaranteed to fail. But then, I don’t need to tell you that :o))
Also very shocked at just how F#cking thick most of the nation really ( and I say this as someone who messed up his education and left school with nothing )
Talking to some of the guys I work with is infuriating , after days of presenting them with alternative news sources and facts relating to how this is virus is nothing to worry about although we need to worry about the mass deception being carried out on us all , thinking I am finally getting through to them . The following day over the morning cuppa and bacon butty I will get ” Guess what I saw last night ? turns out you can catch it twice and get long covid ” and then preceding to slather themselves in hand sanitiser .
Arrrgggggghhh !!!! sweet Jesus save me from the sheep , goons , the unthinking , halfwits or whatever you want to call them , these Morons will sink us all .
This morn as I walked in to town along a suburban street which completely empty save for an elderly woman, masked up, walking stick in hand and walking her dog. As I approach she steadies herself, turns sideways and sticks her head in the hedge (well, she presses her forehead on the privet) she almost flinches because another human has come so close to her.
But eh, the dog has to be walked! People are prepared to risk a lot for their pets.
It’s a dangerous world out there…
I thought you were going to say the dog was wearing a mask!!!
I’m sure it’s not unknown.
Business opportunity for someone.
Sod it, the Chinese have got there first.
Don’t give any of these idiots any ideas.
The old lady or the dog?
for goodness sake. What a stupid thing to say.
That’s very sad! Poor old brainwashed thing.
She won’t mind, providing they’re masked up of course
Keep hearing how “everyone is suffering from the effects of Covid”
No, we are suffering from the effects of the government.
I have been told that in London mosques, leaders are now heavily pushing the government Covid narrative / advice. I wonder if the same is happening with any other religions? Could the government be offering financial incentives? we know they are paying social media influencers and celebrities so it wouldn’t surprise me. Every part of society sadly seems to be easily influenced with a government bribe.
Our Anglican rector, archdeacon and bishop are all total yammering zombies. But cowardice, stupidity and a total lack of faith in God, Jesus Christ, and the Holy Spirit seem to account quite adequately for their shameful conduct.
Bill Gates was interviewed recently and was asked how they push a vaccine in sceptical communities. He directly referenced the tactic of speaking to religious leaders and getting them to publically vaccinate their family and declare support. Its standard.
It’s disgusting! But organised religion has always been about power and control.
JC pointed that out and the priests had him bumped off!
I certainly don’t think they should be telling people what to do and believe in relation to Covid 19. They don’t quite get it, the ‘Great Reset’ is replacing religion with the State and Identity politics.
Not sure the religious leaders know what is in the vaccines, could be against their religions.
Vaccines and porcine gelatine – GOV.UK https://external-content.duckduckgo.com/ip3/www.gov.uk.ico https://www.gov.uk/government/publications/vaccines-and-porcine-gelatine
The issue of some vaccines that contain ingredients derived from pigs (in this case gelatine – known as ‘porcine’ gelatine) has concerned some faith groups. This leaflet provides information about…
So, contact tracing still seems counter productive to getting the country back to normal. Don’t think the people in parliament banging on about it understand that.
It will never work millions in this country dont officially exist
I am also optimistic that part of the reason it’s so poor is because a lot of people are sabotaging it by deliberately giving fake details.
Perish the thought Donald Duck…
Really?
Signed RJ Bingham
Yardley Yeadon points out how pointless it is
https://threadreaderapp.com/thread/1316349182211481600.html
https://www.spiked-online.com/2020/10/14/starmers-second-lockdown-would-do-untold-damage/
Spiked on Slippery Starmer.
Starmer looks like a greasy spicy.
Spiv
COURT 2
COURT 28- OVERSPILL
Before MR JUSTICE SWIFT
Thursday 15 October, 2020
At half past 10
APPLICATION(s)
CO/3546/2020The Queen on the application of Dolan v Secretary Of State For Health And Social Care
Anyone going there to show support?
Is that a made up Judges name?
Swift justice is what is needed, but I doubt that’s what we’ll get!
I got it from
https://www.justice.gov.uk/courts/court-lists/list-cause-rcj
Thanks!
He was born to the role!
Probably goes to the same grand lodge as the defendant
It’ll only be Swift, Justice on his library card
MR JUSTICE SWIFT
for real?
there must be a 33 in there
There used to be a Cardinal Sin.
When I used to ring up my Bank Manager, he would answer, loudly, with his surname:
‘Money!’
His first name was ‘Nick’
It won’t take him long to deliver his only statement: “Case dismissed”.
So do you think it would be pointless to turn up outside the court to show support for Simon?
On the contrary, I am merely pointing out that the machinations of the legal system are not going to help us. Just as has already happened with the political system.
I can see that it doesn’t really matter in the grand scheme of things if one person (or several people) turn up outside the court – it’s not likely to change things. On the other hand, my conscience tells me that I should be there.
Definitely follow your conscience. It’s your best weapon.
Good for you!!!
Perhaps it’s even more important to show support if you can in that case?
I have emailed Sunetra Gupta suggesting that she report Hancock to the Speaker for misleading the House.
Good idea. I cannot believe he is getting away with some of the blatant lies he is coming out with.
Just a reminder that 450 cancer sufferers died today. Plus 5 people in road crashes. And about 1100 others. And it will be the same tomorrow…
We care.
Zombies don’t.
That’s just in the UK. Worldwide every day more than 800 children under five die from diarrhoea linked to a lack of clean water and poor sanitation. If we actually wanted to save lives then think what half a trillion would’ve done for them.
Drakeford said on PM that using the “English System” no areas in Wales would be Tier 2 or 3. So why are we still locked down… ?
Because he’s still a turtle’s head.
Quackerduck.
Because there isn’t a minus 2 tier
https://twitter.com/LewisStoreyPics/status/1316401669161340928?s=20
Pub in Liverpool renamed the Three Bellends after Johnson, Hancock and Cummings…
https://twitter.com/hewitson10/status/1316401998099632133?s=20
Surely Witless & Unbalanced deserve at least one between them?!
The Pair Of Bollocks
Watched UK Column today. The covid passports (Certificate of Vaccination ID) are here. No vaccination passport means no overseas travel. How long before it means can’t go outside your region? How long before it means can’t go outside period? I’ve been writing to my MP these past months and regardless of the specifics I write to him about, I get the same bland nonsense in response. He is such a wet. I won’t stop writing to him ‘cos he’s not getting off that easy. In my next letter I’m going to ask him what he’s doing to help the families of the 7 young men from around here who’ve recently killed themselves. I don’t know of one person who has died with/from covid let alone 7. This is what happens when politicians get mixed up with greedy bastards who want to own the world, everything and everyone. Think I might don some sandwich boards, parade round the town and see if I can wake some people up.
No jab, no life.
On the bright side, they can’t keep people out of the pubs, so the nonsense won’t last long if, indeed, it ever begins.
Rolling out in the NHS as well – https://beta.staffpassports.nhs.uk/
We’ve put a small file called a cookie on your device to make our site work.
Partonising gits!
Scotsman headline tonight
‘Nicola Sturgeon: Scots need to think ‘very carefully’ about travel anywhere’
But there is no definite vaccine yet. What if there never is? Then what? Even if there is one it wont take long before some adverse reactions start. Sit back watch and wait. Then it will have to be pulled. So how can a certificate of vaccination work if there is no vaccine? Many countries are extremely dependent on tourist $s. Are they going to ban tourism forever losing out on those $s? I didnt watch the uk column today so maybe I’m missing something.
I don’t think the perpetrators are interested in tourism. There will be no hospitality left for tourists if they go anywhere anyway.
Have tried to find this but am not sure what it is you’re referring to. Could you give a link please?
https://www.ukcolumn.org/
A while ago someone asked was there any post mortem evidence about covid. I came across this article.
https://www.medscape.com/viewarticle/936155
It has a scary headline but one expert concludes ““But if you isolate the emotional aspect of COVID-19 from the fact, it’s an infectious disease like other infectious diseases.”
https://www.thelancet.com/journals/lanpub/article/PIIS2468-2667(20)30180-8/fulltext
Here’s another
There has been post-mortem data from Germany in the public domain since April – Professor Klaus Pueschel, pathologist at the University Medical Centre in Hamburg went public with his conclusion that no-one he had examined had died of Covid-19 alone, i.e. all of the victims had co-morbidities.
https://www.youtube.com/watch?v=GeykREAlYSg&ab_channel=SkyNewsAustralia
How come this mob in Sky News Australia are actually providing journalism? Will Australia be the last bastion of freedom at the end of all this sh$t?
Fox in the US have been pretty good too. Both still owned by Rupert Murdoch, unlike Sky UK.
Who owns Sky UK now?
Comcast
Just watched it – excellent, thank you!
Sky News (Australia!) has been an oasis of sanity in desert of media hysteria for some time now. Here’s another huge dose of common sense from today.
https://youtu.be/sMisSTjUiR8
The media in the UK has been pumping out fear porn on behalf of the government whilst Sky News Australia have pulled no punches in attacking their governments. Why can’t we have this in the UK.
https://twitter.com/LockdownNo/status/1316445542172495873
Mayor of Liverpool today said all icu beds at two Liverpool hospitals are full. Quietly said 8 beds
I gave him a scolding on Twitter earlier…
Pity you coudn’t give him something a lot more physical!
Telegraph live feed 16:41
This is simply not true! (see my long post today for more details)
How many were admitted with something else and then had a positive test?
More than several, leggy.
100%
https://www.thinkscotland.org/todays-thinking/articles.html?read_full=14292&article=www.thinkscotland.org
Another excellent article by Linda Holt- someone to follow for sceptics suffering from Dominatrix Fatigue.
Sturgeon has questions to answer and the faux sympathy dished out for the faithful is losing its pr polish.
Holt’s account reveals the Machiavellian machinations employed to maintain the cult’s narrative.
The woman is a fucking loon
Scots that can think???
Gosh.
What’s this Scottophobia madam? We are some of us known for our thinking capabilities.
Admittedly, Ms Sturgeon has taken complete leave of her senses, but we have a great many fine examples. See here!
https://en.wikipedia.org/wiki/Scottish_inventions_and_discoveries
https://www.breitbart.com/europe/2020/10/14/pub-renamed-three-bellends-in-tribute-to-boris-cummings-hancock/
Breitbart on The Three Bellends, by Delingpole
O/T. Woman driving that mini, in the picture shown, is going to have nasty accident turning right like that.
It’s a man – in a tie.
Good spot! I should have made the pic bigger.
Apologies to lady drivers everywhere.
Yes especially while looking at a pub sign.
DT – breaking news
It begins! We’re next.
Curfew, yet another term to condition the population into accepting their servitude.
Once imposed, it will never be lifted. Not even after the vaccine.
It’s already been hinted that people who leave level 3 zones for work will soon have to return home by a certain time each evening.
That will be interesting for long-distance drivers, kitchen fitters, electricians etc etc.
But everyone’s working from home now, so it shouldn’t be a problem!
If this goes all the way we will require explicit state authorisation to leave our place of abode for any reason whatsoever.
To be honest – the way this is going I don’t think I’ll want to leave anyway.
Me neither. And I haven’t, except to go outside for a cigarette, for 3 months straight.
You REALLY should get out more.
Isn’t that the plan?
I believe it is.
I keep going out. I go to all the places I care about and like to visit. I spend most of my weekend going out into the world to enjoy it. Christ, it is hard going. I am constantly challenged about not wearing a mask. And I find the absence of other people with faces extremely wearing and upsetting. I will never give up, but representing normality and sanity is a major labour.
You have a far greater tolerance level for the degraded humans currently dominating our culture than I ever will.
Thanks for responding, Richard O. I am very on my own in the current version of the world.
Everyone on here is with you. This is one of the greatest accomplishments of the regulations. The destruction of freedom of association.
Humans?
NPCs that look like humans.
Good for you, I’ve mainly gone recluse these days.
Kudos for your efforts!
Unless we insist.
Macron – Globalist par excellence, chief of the Lockdown Lunatics, the man who forced Johnson to abandon the herd immunity strategy by threatening to close the Channel .
Latest message from Oxfordshire County Council on the A40 traffic announcement board:
“DO YOUR PART
DOWNLOAD THE NHS COVID 19 APP”
To quote Dr. Evil: “How about no?!”
Hasn’t every person passing under that been doing their part for the past6 months – do your part is getting old. It is also offensive to some who have lost throughout this scam.
They do not seem to be using “we are all in this together” anymore.
Not even in an ironic way?
DO YOUR PART (TO ENSLAVE YOURSELVES).
Some months ago I was going to upgrade (ha ha….) my 11 year old Nokia phone to my husband’s retired smartphone. However he couldn’t get it sorted out for me to use, and since the virus came along I have decided it’s much better that it stays in whatever drawer I put it in. I think a smartphone is the last thing I want nowadays….
Zip it!
Eh?
Looks like Greater Manchester & Lancashire are being put into level 3 tomorrow.
Poor sods!
I’d better check.
They often put us the wrong side of the Pennines!
we haven’t even had tier two restrictions for a day and they are changing it already!
I’m in a seaside town in Lancashire which is next to a city with a uni. Most of the “cases”are from the uni and the city but our town hasn’t got many “cases” at all and we are getting lumped in with them.
Well time to be a rebel and ignore the new rules again
I think it’s more important to be outraged at all lockdowns, not just the ones on your doorstep.
Agreed – but some mockdowns are more outrageous than others!
It’s the cockle pickers you need to watch out for.
Love calling it a mockdown! It’s all about control with the government and the local councils.
I am outraged at putting any lockdown in place, it’s a virus not the plague!
Thankfully most my friends are sceptics as well
What does the panel make of this in the Mail today? Comments are overwhelmingly pro-sceptic, but I guess those of that persuasion would be drawn to comment on the article.
https://www.dailymail.co.uk/news/article-8837153/One-four-Britons-believe-Covid-19-developed-Chinese-lab.html
It does sound like a classic conspiracy theory but China is a massive place and what are the chances that the market at the centre of the initial outbreak is just 23km from the lab that experiments with corona viruses?
Plus I heard that the lab just stole the blueprints for a virology lab from France(?) to build theirs but didn’t bother with the proper foundations/drainage/filtration that you need.
They’ve also been implicated in smuggling of pathogen samples from the West to China (PLA operatives posing as scientists to gain access). A fact that even BBC Reality Check cannot vapourise.
I understood it started in a US lab and was sent to be worked on in the Wuhan lab by Fauci.
If it hasn’t happened already, China now knows how to take over the world- just release a new virus every year & scare everyone s**tless!
Uncle Bill already has that in hand:
https://www.youtube.com/watch?v=q-aY-h59Gx8
Yup! Looks like you’re right!
A crowdfunder to help bring a case against the closure of gyms is very close to its target – if anyone can help or wants to read more here’s the link and a snippet.
https://gf.me/u/y4qdig
UKActive published this study – https://www.ukactive.com/news/fitness-and-leisure-sector-reports-covid-rate-of-0-34-per-100000-visits-since-reopening-in-england/
• 22,000,000 (22 million) gym visits resulted in a mere 78 Covid cases
• Uk gyms showing just 0.35 cases per 100,000 visits
Then we have the latest (unpublished study) since the increase in positive tests https://www.bbc.co.uk/news/uk-england-derbyshire-54464470
• Gyms are still only showing 1.7% percent of cases, but they want to close us and keep restaurants open which have a higher rate of 9.6% cases, which is still CRAZY LOW so these should also stay open.
Mental health – the gym helps so many people with their mental health daily.
• Male suicide is now at an all time high – https://www.bmj.com/content/370/bmj.m3431
Just donated a fiver – the least I can do for these people.
Thanks for sharing this. Just chipped in a fiver. The initial goal is £10,000 and they’re almost there in one day.
£11,000+ now
£1K from a Charlie Mardon.
Donated – managed to add MabelCow’s latest picture to my comment.
The figures are for last year. After this year, they will be off the charts!
I’ve just seen that an independent shop I used to visit a lot back when life was normal have installed a fogging machine which emits a fine antibacterial mist to disinfect all surfaces in the shop. Surely to god that can’t be healthy for the staff who have to work there all day?? Don’t think I’ll be back now or order anything online as I don’t want it covered in gunk. Has anyone else come across such a machine?
Sounds like something that needs a very thorough risk assessment, which I expect it hasn’t had.
There’s one at my previous gym (which I left due to bonkers rules). It does make the floor and surfaces slippery and they’re ruining all their kit that’s going rusty and rubber and plastic is perishing. Spent the first couple of mins of my workout wiping it off everything.
That’s got all the makings of a law suit when someone slips and breaks their neck.
The shop I’m referring to sells dressmaking and soft furnishing fabrics so I definitely don’t want anything from there now as it will be ruined by the stuff they’re spraying. Honestly, I think some of them actually want to go out of business.
It will either make the fabric go mouldy or, if it inhibits mould growth, will make the shop staff ill.
The school Mrs leggy works at have one – her and the other staff read the warnings on the packaging of the chemicals they were supposed to spray around. Nothing good. They decided not to use it, but they have a special “ofsted” inspection coming and no doubt they’ll be pulled up on it.
They should make it mobile and have it pointed at the ofsted inspector all the time.
I’m glad the school staff saw sense and I really hope Ofsted don’t pull them up on it. If it is enforced then I hope a parent sues the arse off them when a child has a severe allergic reaction. Given that schools these days can’t even administer Calpol without a risk assessment it shows how bonkers things are that they expect children and staff to breath in toxic chemicals all day.
Tell them it didn’t pass the risk assessment and so couldn’t be safely used.
We went to Greece last month and the easyJet flights both ways had them. Wasn’t a problem. Looked a bit funky.
A colleague at work used to have on on his desk. Only water vapour as far as ai know.
Antibacterial spray is really going to whack that virus, ain’t it?
I’ve left a comment on the shop’s Instagram page asking about the risk to staff and customers from breathing in chemicals and also about residue spoiling the fabric. I’ll let you know if I get a reasonable response or shot down in flames for challenging their ‘Covid secure’ bollocks.
Here’s a more playful version of my discriminatory-challenges document. Put in on a t-shirt and do away with the hassle of saying, “I’m exempt”.
The best yet
Say “mask” again. I dare you. I double dare you!
Wow! That sends a message!!
Love it!
Brilliant !
Brilliant!
I love it!
Very funny!
Oh God, I wish you would come to the supermarket with me.
…and I wish Jules Winnfield would accompany me.
I really look forward to the Bill Gates “second generation super vaccine”. Lockdown until then of course so let’s hope it works on skeletal remains.
The second isn’t going to be up to much either, and I hear the 3rd generation is only going be at most 50% effective, though it will have much better tolerability and safety characteristics. The fourth generation though, should, all going well, be much more effective (55%+).
That should be hilarious but it isn’t funny under the circumstances.
Not a conspiracy theory — it’s all out in the open. These bastards are proud of it and the masses will eat it up.
Ahem … Quite by accident I just came across the following:
In an impassioned speech before the United Nations General Assembly on 24 September 2019, UK Prime Minister Boris Johnson stated that digital authoritarianism is not the stuff of dystopian fantasy but of an emerging reality. He described the Internet of Things, “smart” cities and AI as a giant, dark thundercloud lowering ever more oppressively over the human race, a gathering force reshaping the future of humanity over which the human race has no control and from which, in future, there may be nowhere to hide.
He asked if algorithms could be trusted with our lives and hopes and whether machines should be allowed to doom us to a cold and heartless future in an Orwellian world designed for censorship, repression and control. He recalled the Universal Declaration of Human Rights and endorsed its ideals of upholding freedom of opinion and expression, the privacy of home and correspondence, and the right to seek and impart information and ideas
More at https://www.globalresearch.ca/telcos-losing-battle-impose-5g/5691065
I often wonder, given how every aspect of the human experience that is uplifting and creates community has been mercilessly and relentlessly targeted for annihilation, whether AI is already in charge.
Now there’s an interesting idea!
There is a new drama series on Fox call neXt which explores this exact scenario. We would all like to think that this is still confined to the realm of science fiction, but the sheer scope of the war against humanity itself is so breathtaking that I cannot help but speculate otherwise.
Has AI been fiddling with Ferguson’s spreadsheet?
Definitely not, only a stupid human being would use Excel for data modelling.
When me and a friend would muse on the future in happier times we always came to the conclusion it would be like terminator minus the time travel
When I was a child a popular expressions was ‘S/he’s faced all round like the Royal Liver Clock’ (I’m from near Liverpool). Would this be appropriate for the Rt Hon Never-Going-Back-to-Normal? MW
Now that he is part of the elite and will be immune from it, he approves.
That is just unbelievable.
No it’s typical.
Do you remember when Toby described DePiffle’s first Oxford debate? He seemed to think it showed his talent.
I thought it demonstrated his complete lack of conviction and scruples. The fact that he spoke for both sides of the argument showed that he didn’t give a toss about either viewpoint and was effectively mocking the debating society.
Shallow, arrogant, barefaced liar!
Barefaced ed? How does he manage that?
We need to support these guys, I think this could be the start of the tide really turning, real people, telling real truth and standing up to the lies:
https://m.facebook.com/EmpoweredFitGym/
See Hannahbanana’s post below.
We have big movement.
More news coverage today.
MP’s are backing us.
Meeting with a big corp who wants to back us vocally and legally.
Meeting with the Mayor.
We will do this
We stand with BodyTech and all the others (70+ now)
Interview on the Beeb at 9.30. I hope they’re given a fair opportunity to put their arguments properly.
They were given a good chance to put their case here:
https://www.bbc.co.uk/news/business-54535679?fbclid=IwAR11NMwpRuqC-xdMqr7zsYZhZPpmVswYrfnw_SFHrqGfw0h0DbFYDOCqwQk
We do.twice as much testing as any other European country crazy .just a useless stat today both holland and belgium posted over 7 k infections
They both have populations well under 20 million which would mean taking that in to consideration they would have a rate to day of about 50 k today com.pared to us.
Wasnt boris impressed with Belgium’s stratergy he even go the 10 pm p curfew off them.
Belgium – second only to Peru in the world Covid death league.
I thought they got their ideas from Demented Dan in Victoria, Australia – curfew and all.
Was in M & S today. Could not believe the latest. Apparently you can now book online to be given a slot to shop in the store – enables you to bypass the q! Unbelievable
At least they don’t challenge masks.
I suppose it’ll be better than standing outside in the cold and rain, which I suspect is soon to be reinflicted on us.
Interesting – our local Waitrose has a covered approach, the local Tesco and Aldi do not.
Most supermarkets don’t have cover except for the trolleys!
They were originally designed to welcome loads of customers straight in, without impeding their inward progress.
Likewise here and add Sainsbury’s to Tesco and Aldi.
Once again can I put in a plug for Talk Radio. I’m nothing to do with the station but I am finding it vital for maintaining sanity during this second descent into mass hysteria and acts of self harm on a national scale. Every time I tune I hear sceptical arguments being given a fair run and presenters asking the right questions about the Lockdown Lunacy. If you haven’t come across it yet, give it a try. It’s like living in a parallel universe – a sane one.
Yes we like all the presenters – not always bothered about Ian wotsisname in the afternoon but Julia Hartley-Brewer, Mike Graham and Dan Wootten are great. Only proper issue is they are ok with muzzles.
I think most of them admit to supporting the first lockdown which lends credibility to their strong opposition to these fresh acts of national self harm.
Can it be long before Ofcom move in to close them down?
Have to say I was on board initially – to flatten the curve made some sort of sense then (sorry if that offends anyone here!) – although even on day 1 I did say theres something funny going on. I think I was in shock really though at that point.
Yes I was similar, but only on the basis that the government had incompetently failed to plan for a pandemic, and so we had to try and slow the spread initially. That justification no longer applies.
Yes – i thought he was better today, but sometimes just sounds a bit wishy washy or confused
Maybe he’s still getting there.
Mike’s interview with Neil Oliver was worth a listen/watch.
James Whale in the evening is a disappointment, this evening I turned over to LBC, Iain Dale was even more disappointing.
Shame, I used to love listening to James Whale back in the late 90s.
I think in fairness to them they are going along with the rules on masks without great enthusiasm. Mark Dolan cut one up on air, but on their “Plank of the Week” review a week ago admitted to wearing them even when he did not strictly have to.
Yeah – the news headlines are bizarre….so I switch back to music for 20 minutes or so.
Caught Talk Radio earlier for the first time this afternoon, a Kiwi (sounded like) chap casting doubt on the latest lockdown mania. Great interview with the rebel-ish MP Loughton. I couldn’t believe it, hearing a broadcast with a dissenting tone. Will listen again!
Agree with all the above. Talk radio is the best radio at the moment. Great interview with neil Oliver this morning. Have stopped listening to BBC altogether now.
LOVE LOVE LOVE Neil Oliver! Could listen to his voice all day.
I posted one of those interviews on fb and said that he has more humanity in his little finger than a million Wancock’s could only dream of.
Have a look at his recent interview on Sunday Brunch too if you can find it (back end of September) – he leaves Tim and Simon speechless.
Great man!
Well that’s some good news for today!
Welcome to broadcast sanity.
Time to switch off now Dr Hilary Jones is on soon…pushing flu vaccines so I’ve gone to talk sport for light relief!
I know what you mean Petgor but it kind of shows up the malevolent propaganda being delivered by mainstream news.
Their adverts are as well. “I wash my hands to protect my family” bollocks, drives me insane. I’ve emailed them twice about it but had no reply. Love the station though, most if not all are skeptics, especially Kevin O’Sullivan.
It is great! I listen to the Youtube version, can fast forward if needed
The Pointless Numpty Covid Rules Award of the month goes to… The Woodland Trust.
For implementing a one-way system around our local ancient woodland. Yes, a woodland. Outdoors. In the fresh countryside air.
Can anyone beat that?
The RSPB at Fowlmere Bird Reserve in Cambridgeshire. One way system through woodland. All the hides closed. ‘Keep you safe’ mantra all over the place.
Croome Court, Worcs – National Trust. One-way system through wide rolling acres of parkland.
Not going THERE again. (Actually, not going anywhere NT again – they’ve lost me and my family with their ridiculous anti-slavery agenda.)
Obviously the conservation/nature charities are all at it!
I’ve been to Fowlmere. Hardly overrun with people normally is it? Not exactly difficult to antisocial distance should you want to.
What the actual fuck???
Almost. Our local woodland has 2m ‘social distancing’ signs…
Donna Nook Seal sanctuary, IT’S A 6 MILE LONG BEACH! They want people to book so they can maintain social distancing.
https://www.lincstrust.org.uk/get-involved/top-reserves/donna-nook
and the winner is –
National Trust has been doing it for months.
Have you seen the series “Brain Dead”?
(If not I can thoroughly recommend it – very apt for the current times and absolutely brilliant political satire.)
I think the managers at the NT have been taken over by the alien ants.
PS.I ripped down the first four NT nag notices I saw. And I was really annoyed that their foul one-way sign pointed the way I actually wanted to go.
Mr Contrarian unscrewed the one way notices with his pocket tool…
Oo-er missus.
Abbotsbury Swannery in Dorset. All outside, except the small shop and restaurant, but you have to book an hour slot on line. It also has a one way system, the hides are closed and there are the usual signs for keeping safe. Similarly at the Sub Tropical Gardens just long the road. Acres of beautiful gardens but with their one way system at least a third is currently inaccessible. Also need to book an hour slot on line.
Even more madness out there than I thought!
God bless the Liverpool gym owners standing up to the government. I knew Liverpudlians would be having none of this.
The fund is now over £11k! Brilliant work
Where’s the fund?
https://gf.me/u/y4qdig
Ta – donated
Thanks. This is getting expensive…
Now up to £13k.
Pushing 15k!
£16.6k now!
Over 12k now.
I just donated. Best £5 worth I’ve had in ages.
There are some pretty heavy characters in Liverpool gym ownership.
You think they’d have lost weight, not put it on …
Video here. The guy’s raw emotion is heartbreaking. Pleased he has had a lot of support. https://twitter.com/JuliaHB1/status/1316468926390337541?s=20
Heroes.
I just read on Facebook that armed police turned up to issue fines (or, rather, Fixed Penalty Notices). I can’t confirm this.
Surely not armed??!!
Armed police were stopping drivers in Wales in the Spring. Local MSM reported it like it was completely normal.
Apparently the sun newspaper phoned the police, inciting public unrest. Cunts
That’ll seriously hit their sales in Liverpool. Oh, wait, hang on …
Not that they will take any notice of the Sun of course!
They are mad enough to put in a 2 week lockdown which would probably last months.
Will they pay full furlough, and offer Grant’s like they did before?
If they do not there might be a problem.
And if they do it will cost a fortune.
Money doesn’t matter anymore, it’s only a matter of time before the entirely monetary system collapses.
That’s what I think and it must be deliberate.The way money is being spent the government can have no intention of ever paying it back
Same goes for local councils frittering away their budgets with needless road “improvement” works throughout 2020.
Exactly.
They are all in free spending and grab a piece of the pie before it is too late mode.
I just can’t see how, politically, Johnson could survive bringing in a lockdown after Starmer’s intervention.
Say he “really didn’t want to” but he had “no choice not to save lives”.
It’s been the same model from the start,why change a winning formula.The only thing that can stop a second lockdown next week is significant pushback between now and then.
we are getting a 2nd CYCLE not a 2nd wave.
Oh I forgot.Simon Dolans court case tomorrow as well
Phew -it’s all an illusion https://www.express.co.uk/news/science/1347843/are-we-living-inside-a-simulation-nick-bostrom-simulation-theory-elon-musk-evg
A simulation model designed by Ferguson and using dodgy software and excel spreadsheets as a platform, perhaps…..
Perhaps we switched over to the simulated world at some point in 2020. It feels like a very poor imitation of the real world that I used to inhabit. Especially since the rise of the masked NPCs.
Leave them in the wilderness with a pen knife for a few weeks, then they can make a better call.
It is an illusion. If everyone decided not to comply at the same time, everything would be back to normal. We each hold the keys to our freedom.
Anyone else heard about this??
Boris Johnson considering two-week England-wide lockdown for half-termIt is reported a decision will be made at the end of next week, with one source claiming the likelihood of the U-turn is “at least 80 per cent”
https://www.examinerlive.co.uk/news/uk-world-news/boris-johnson-considering-two-week-19099796
Is it just speculation or are we being primed?
Always on the cards, has been since July. And it won’t be just for 2 weeks.
My local “leaders” seem to be gagging to be put into tier 3!
Sounds like a porn movie. And a bloody awful one at that.
Devi Does Davos
Superb.
What do the half terms have to do with anything and lockdowns. I really 100% don’t understand the logic behind it.
Don’t need to shut the schools again
yer but How does that work? Really I just dont get it, the rules make literally no sense, shutting pub early the alcohol rules now the half term thing….I know its all mental but I just dont get it
Theatre.
The only thing that makes sense is that we have had a coup.The rest is mental torture as we struggle to make any sense of the governments actions.Meanwhile they get on with their true purpose which is to cement their power
They do if it’s for any longer than 1 week.
They say it will “minimise disruption” but of course it’s to stop people going away and mixing at half term and will conveniently outlaw both Halloween and Fireworks night.
There are lots of kids events planned for half term of course. All those would have to be cancelled and a ton of revenue would be lost.
Nothing whatsoever, but it makes sense to the cult members.
Saves an outcry if they officially closed schools. Plus a lot of parents will already have booked time off work to babysit.
Christmas cancelled or a ploy to claim he “saved it”?
The latter wouldn’t surprise me but he’ll prevaricate till it’s too late to sort out the food orders.
Primed. IMO.
Eliminates the last hope for holiday-dependent businesses everywhere.
And the last hope for holidays themselves.
Good lad, our James …
Oppressors can tyrannize only when they achieve a standing army, an enslaved press, and a disarmed populace.
James Madison.
Tick, tick, tick. Not a good outlook.
We gave a disarmed press and an enslaved populace.
Looks like I don’t need to worry about breaking off connections with my family over their zealot status – the Irish Government has banned household visits. As I live alone and am WFH, I have been put into solitary isolation.
https://www.rte.ie/news/coronavirus/2020/1014/1171431-coronavirus-ireland/
Just tell them they will never see you in person again.
Maybe they’ll change their minds in the interim!
Of course the contradictory aspect of this new rule is that I cannot visit another household, but the tradesman I booked to install an attic access ladder in two weeks can come into my house to do so.
Your mates should become ‘tradesmen‘. Rishi’s keen on people re-training.
They already are tradesmen, they just don’t know it yet.
I’m moving house in a few weeks. My brother’s ‘trade’ is van driver (and he lives just across the border on the other side of the Dee, so he’ll have to dodge the barbed wire and machine-gun nests). And we have several ‘professional’ box movers in the form of my wife’s mum, our daughter’s best friend and her mum.
I just hope there’s no Coronafascists among our new neighbours or we’ll have the constabulary around on the first day…
I’ve had six different tradesmen over the last 2 weeks, (despite the fact that they’re in and out of loads of people’s houses) but my granddaughters aren’t allowed to visit.
So basically, it’s perfectly legal for people to visit – so long as you pay them.
Couldn’t your granddaughters come to inspect your boiler, cheezy? Or fix your refrigerator?
They can come and do whatever they like as far as I’m concerned.
It’s their mums that are the problem. My son hasn’t seen his own daughters for weeks now.
This anti-households mixing thing is extremely effective!
Legally, I have to choose between seeing my best friend or my son.
My granddaughters’ next task is picking apples. Not going to pay them a lot, mind …
They’ll enjoy that!
Isn’t this ridiculous? Bare-faced manipulation!
”There are now more people in hospital with Covid than on March 23rd”
Yes – well, there WOULD be, wouldn’t there? They weren’t testing then as they are now. Now anyone who goes into hospital is tested and (ignoring the tyre marks and heart attack) is counted as a ”covid admission” if (often false) positive. That inflates the figures very nicely.
That people can’t see they are being lied to, and coerced and manipulated is very depressing.
In Wales, you don’t even have to test for Covid, only ‘suspect’ it and whacko, up go the figures.
That’s what they have been doing at the hospital my daughter works in (in England) for months,treating every patient as covid,tested or not.
They’re probably testing the sheep too.
I think they were testing hospital patients in March. However, the comparison is a bit misleading.
On March 23rd number in hospital was 3097; 5 days later the number was 7017 – an increase of 127%
On October 9th number in hospital was 3097; 5 days later the number is 4146 – an increase of 34%
Patient numbers are increasing at a much slower rate. It’s still a bit worrying though. We need to see a peak in the hotspots soon. Manchester might be slowing.
I think it’s fairly obvious that this is a seasonal bug. But is the worst at the beginning of its season or nearer the end?
Manchester slated for tier 3!
Every fucking body in hospital has had a dodgy + so of course there are more covid people in hospital than there was on 23rd march.
It’s a conspiracy fact
I mostly agree except for the “bare-faced” bit.
A fairly long Twitter thread. New idea over several tweets:
https://twitter.com/RobertJ62035232/status/1316471016365920257
Very good!
An excellent idea. Anyone who is scared lives in total lockdown for as long as they wish. Leaving the rest of us to go about our lives unmolested.
Lock them in. Seal up the windows and lock up the door. Feed through a tube. Keep in a permanent bath of antibacterial gunk, except when put in a bed with rubber sheets. Mask surgically attached to face. Ooh, I like it, I like it.
I’m loving the sound of your new Covid Safe Home Solutions.
Write for catalogue.
No obligation to buy, unless you are a zombie for whom
everything not forbidden is compulsory.
Strictly no coupons, haggling, reductions, or cut-price offers via Ebay.
There will be a Covid Accessories section in the next Argos catalogue.
Excellent solution.
Force them to wear bedwetter badges. Let’s see how that goes down..
A couple of people gave me useful critical feedback on the chart I posted yesterday comparing hospital bed occupancy and deaths so I have redone it with more granular data plotted weekly instead of quarterly.
Wow! A picture certainly tells a thousand words!
Couldn’t agree more. Good work, Bob.
BobT, I think that’s the graph of this whole incident. There’s even a lag.
Excellent stuff! Thanks.
So, hospital occupancy dropped to it’s lowest level in years, followed by the biggest single spike in excess death in years.
Well done. If this can be confirmed, it’s another major piece of evidence
I would really like to get Heneghan’s second opinion on that. It confirms my view that, of the 50,000 “excess” deaths in April, about half were self-inflicted.
Once you factor in alternative causes for a higher death rate in April, I suspect the true number of excess deaths and certainly lost life-years is quite low. For example, fewer people died of chronic heart disease in May and June. Lockdown does not cure heart disease. Obviously these same people died of an infection a few months earlier.
I too would love the Great Heneghan to check my work!
I am starting to believe that ALL the “excess deaths” were caused by chucking people out of hospital.
I say so because if you look at Euromomo country data about half the European countries show no excess deaths at all in April. Do not quote me because I am still researching this to see which countries emptied their hospitals and who did not…….I am still trying to find out.
Bob, given the news that the government are planning to shove all the oldies out of hospitals and back into care homes again, (https://www.telegraph.co.uk/news/2020/10/14/care-homes-told-prepare-isolation-facilities-covid-positive/) could you keep the forum updated weekly with this graph? it would be very helpful.
What was that about insanity and doing the same thing over and over but expecting a different result?
I will be happy to update this so long as they keep publishing the data………finding hospital data before 20 March for the chart above required pulling bits of info from all kinds of different sources.
Great thanks
Just done a risk assessment of me catching Covid-19 using the 3 C’s, a D and a V and it say’s I have a 0.00008% chance out of 100,000, so I am off some remote hill until Christmas or if anyone knows of a remote island I will consider that….. :),
Don’t forget your mask (just in case).
” Dr Tom Cowen and Sally Fallon Morrel discuss the contagion myth ”
now on you tube
Sorry I can’t post links but have a watch , Dr Cowan has some fascinating information.
Germfree Adolescent-X-Ray Specs
http://www.youtube.com/watch?v=DGROSJbCPV8
It’s odd how those previously thought of as mad now seem eminently sane compared with Starmer, Johnson, Hancock and the whole of the mainstream media.
It’s never been so blatant. This is totalitarianism. Those in power are blatantly, obviously lying – and it doesn’t matter. In fact, the message deliberately sent by such blatancy is that we are powerless, that we don’t matter. Hancock could spit straight into the camera – so what? Johnson and Starmer would just line up behind him to add their spittle to the lens. The message is clear and deliberate.
I’ve not read a post from Toby so frighteningly cold and measured as today’s. He gets it. If they can talk and act as they are now, we are being deliberately sent a message, and it translates: ‘You little people are all fucked and there’s nothing you can do about. We will do whatever we want.’
We can do whatever we want as well. This is the very clever trick on the part of the leadership. They know full well that their regulations and related punishments for infringements have no legal basis. This cannot be done without our consent.
If we are moving into a totalitarian system, it will be the strangest yet in history. Completely self-imposed in the minds of its subjects, rather than at the barrel of a gun.
Other tyrants have acted like that.
And ended up hanging from lamp posts, shot, torn to pieces, taking poison, or incinerated outside a bunker. When the worm turns, you suddenly find it’s a toothed serpent.
The famous picture of Mussolini strung up upside down is a good example.
See e.g.
https://foreignpolicy.com/2015/04/28/did-the-brutal-death-of-mussolini-contribute-to-hitlers-suicide/
Weekly foraging trip to Aldi earlier this evening.
Absolutely no sign of any hangel or trolley cleaner near the entrance. They only played the nauseating covid-safe announcement once while I was there too and it’s definitely at a lower volume than at first.
It wasn’t busy, maybe about 15 customers, but everyone except me was bemuzzled.
When shopping, I tend to go a bit tunnel visioned on my shopping list, so wouldn’t normally engage much with other customers anyway, so it doesn’t bother me overmuch.
However, one guy was very brazenly wearing his muzzle below his mouth and gave me a lovely conspiratorial grin as I joined the checkout queue.
The checkout operator put on a visor to nip out from behind her till, so at least I could see her smile back at me. The other staff wear muzzles when on the shop floor so it was her choice.
She took off the visor once back behind her screen and we had a lovely smiley chat about how dark the evenings have become as she scanned my stuff.
A pleasant enough experience.
“Bemuzzled” is up there with the best.
Nice experience at my local supermarket this evening.
My wife has sever asthma, but feels too intimidated to go shopping alone maskless, despite her bona fide exemption, so I’ve begun to tag along, maskless of course, to support her.
She had a bit of a panic at the entrance. I’d strode past the masked-up security guard, but she had scarpered – convinced he was going to give us hassle. I returned to the entrance, and had a word with the guard, asking him to reassure her that she would be ok coming into the store without a mask, because of her exemption.
He did that cheerfully, and in we both went. Hats off to him.
We’ve never had any hassle from any shop staff,they’ve always been friendly and a lot of them genuinely seem to like talking to someone not masked up.
The only abuse has been from other customers.
I steamed into the local Lidl earlier, maskless, mid morning, to buy some milk for work cups of tea. Nobody said a word.. I am 6
4. That may have helped. That and my perpetual disdainful scowl. One old feller looked at me like I was a triple headed space alien. I ignored him. Fuckem.You should’ve picked up the middle isle chain saw and give him the look
I think we have got to the point now where we have to say: “So what?”. So there’s a new virus and more people than normal (at least in the past five years) died in April. So what? Imagine if we had discovered an entirely new disease and our life expectancy were 80.73 years instead of 81.16. So what? Imagine if, instead of being in a care home with dementia for two years, it were now 18 months. So what? Imagine if we had a bad flu year. So what?
What are these health guardians trying to achieve? This is not an argument about health versus the economy. It is an argument about abstract medical and numerical benefit versus quality of life.
Agree completely. At the point at which the average (median) age of death with covid is 82.4 vs 81.16 from all other causes the only question can be ‘so what’.
“But if it saves one life”
Have you ever been in the dementia section of a care home?
If so, you’ll know that in there, the meaning of ‘life’ is highly debatable.
I wish we could put our Fascist oppressors into such a ward, seal up the door, and leave them to it.
Only the state can solve this crisis – Benito Mussolini
At least the guy had charisma, and his demagoguery was convincing. The same cannot be said for the current bunch of insipid, empty, featureless imposters occupying the positions of power.
No flair in our lot.
Benito versus Matt isn’t really a play-off, is it?
Benito had a high bar: he had to make trains run on time.
All we’re asking of the UK government is that they run the trains and allow people to use them, rather than imposing more lockdowns and making people wear useless filthy face rags.
They’ve been returning to this gym every THREE hours to issue £1k, then £2k, then £4k fines. How the fuck is that justice? I know what I want to say here, but I’m not going to say it. It’ll only get Toby into trouble. I’m sure you can guess, just don’t say it, please…
https://twitter.com/emmakennytv/status/1316485591907872768
^^^link^^^
Then the gyms refuse to pay the fines in unison and wait to go to court. The backlog will take years to process, and the laws under which these fines are being imposed are next to illegal in and of themselves.
The solution is separation from the system, not participation in its rituals. Force the hand of the authorities so that their only option to implement the regulations is the use of deadly force.
Very sadly, I suspect these cases will be ‘fast tracked’.
Yep – elastic justice it’s called.
I hope this is all being documented by them and that the story will gain traction. It’s the only way to really force the issue.
They’ll be making an example of him.
Let’s hope the tv coverage has expose the armed police being sent. Surely that will finally wake more people up to what’s really going on!
Did anyone see any of it?
Not me.
The money being raised is to fight the fines, not to pay them. £18 raised so far.
Bit more than that surely?
Think Londo must mean £18k. The fund will grow hugely if thry continue to persecute him.
They sent 7 or 8 firearms officers!? This man is fighting the good fight. Hat off & maximum credit & respect to him.
I visited my parents for tea this afternoon. They are going on holiday tomorrow. That seems to have been well timed.
My mother is no zealot, but she is not as covid sceptic as I am.
One issue that did come up on my visit was the bewildering about of stats that are around at the moment. She told me that she doesn’t know what to trust. I tell her not to trust what they say on the telly, but the older generation, especially, find it hard to give up reliance on it.
This is one of the things that those of us who oppose lockdowns are up against. People are (deliberately or otherwise) being “blinded with science”.
Even I (a science graduate with a particular interest in the biological sciences) find the sheer volume of stats and figures overwhelming. It’s so hard to take it all in.
And while I deeply appreciate the time and trouble some people are making to produce decent graphs, I am quite frankly, sick to the back teeth of the sight of them!
lol, Honestly, I’ve seen enough fucking graphs this year to last me a lifetime.
I’ve said before. This is entirely a statistically led pandemic. If you look out your window there isn’t one.
In a nutshell!
The only thing novel about this virus, is the hysterical reaction to it
Just heard that a guy I know in the village has committed suicide, hung himself in his kitchen, that is the second suicide in our village in the last month, I have no idea what part lock-down played but one can only guess that it did not help.
Why are they are they doing this to us? Listening to some of the comments from
mayors and politicians today I think they are all control freaks and they cannot abide the idea that this disease is not under their control. Even though King Canute showed them years ago that there are some things that Kings and politicians cannot control and have to just live with. They just cannot get their heads around the fact that this virus will do as it wishes and will not be contolled by them and their lock-downs and we all suffer as a consequence.
They are abusing and misquoting data and stats to justify all this hoo-haa, dodgy test results (cases/infections) and hospital data based on ??? The stats that are hardest to skew are the ONS death stats for total registered deathsfrom all causes, i looked at the figures for the last 10 reported weeks (weeks 31-40);
Total registered deaths 2020 92958
5 year average for those weeeks 91305
So that is 1.4% above average, probably within statistical tolerance and probably down to additional cancer and stroke deaths from non treatments. So all in all hardly a reason for the current round of over the top actions. The Mayor of Liverpool was on the news saying they had to do this lock-down to prevent a huge number of deaths, sheer speculation not based on any current evidence and so we all suffer.
Sorry to hear about your friend
Suicide is going to become one of the leading causes of death, I’m certain of it.
We need to hang Hangcock to save others from hanging themselves.
I did a quick straw poll at the pub earlier, after having explained the psychology around the human compulsion to comply with herd behaviour.
Asked who had looked into whether masks are actually effective. 100% of people other than me hadn’t looked into it at all, and 100% people who had looked into it (me) have decided that cloth masks are useless for reducing viral spread.
One guy said even if he had looked into it and found they weren’t effective, he’d still wear one, for purely psychological reasons. I accused him of striking fear into the heart of people like my grandma, who believe they’re at very elevated risk compared to normal and that him wearing a mask reinforces this. I’ll let him mull on it and keep chipping away ha.
Good for you!
How can people spend so much time in the house over the last 7 months and learn absolutely nothing…
Learnt a shitload to be honest. Not through choice however.
Seemed necessary
OMG! Here’s something to make your blood boil!
Check out this disgusting, lying bint onTalkRadio: https://www.youtube.com/watch?v=JrU19kZtZRw
Everything coming out of this moron’s gaping maw is either blatant lies or sheer, unutterable ignorance. She is supposed to be a doctor! Did she even go to school?
She also said, “Herd immunity does not exist.”
Is this the new ‘cancel culture’? Are they just going to rewrite all the medical evidence to suit their agenda?
Said it above, I’ll say it again: “Who controls the past controls the future: who controls the present controls the past.”
Edit: fixed angry typos.
She’s not even giving time for that mouse turning the wheel in her head to catch a breath. Poor thing.
Politico savaging the jumped up Pratt Hancock
https://youtu.be/FBGaNOkC0hY
I hate the sound of Footpenis’ voice. It feels like vigorously rubbing a cheese grater over soft fleshy parts…
Mind you, Politico has really got Footpenis sussed: a “spectacularly petty-minded little man.”
That’s just brutal. The most stark thing (not touched upon) is that the tail end of the UK graph when compared to Sweden shows the incompetence and/or criminality going on with the testing/reporting in this country from a few weeks back to match the narrative.
It’s plainly obvious that Hancock doesn’t write the stuff he reads out; he simply reads it out. He’s got absolutely no idea what he is actually saying.
So what epsi-minus semi-moron gave him that bit about the malaria?
Hopefully the powers that be will listen:
https://www.dailymail.co.uk/news/article-8840965/PROF-ANGUS-DALGLEISH-Matt-Hancock-survived-axe.html
Days must be numbered now. The tsunami has just reached shallowing waters.
God I wish it was. Barely a ripple, never mind a tsunami
Tick Tock Matt. Tick Tock.
No comments?
Moderated. It’s directly questioning the narrative. Depth of feeling on other unmoderated articles is clear.
About 70 now.
Gupta’s response in Unheard was pretty very polite, but to the point!
She’s a very classy lady.
He seems to be bizarrely bullet proof. Just pops back up again like a horror show corpse no matter what you do.
Just had a chat with someone who wanted a second lockdown. She said we had to because there had been 250,000 deaths due to covid
Scary isn’t it?
Extremely!
Damn right, it’s a lot more than I realised…
Surely she meant 250,000,000 in the UK alone.
I did make sure she was talking about the UK. I put her right and she seemed a bit more sceptical after our chat.
Globally it might have been 14 trillion
Does she know that Covid is the sole cause of death these days?
I didn’t get on to the fraudulent cause of death stuff.
I know the feeling, it has to be baby steps to unravel the brainwashing. The temptation is always there to bring out the heavy artillery. Excellent work nonetheless.
Save that for round 2.
She’ll have enough to come to terms with for now.
Surely, the first known case of death in human history occurred in March this year due to Covid.
With facts like these, who needs sceptics?
Well that explains everything!
I personally know over one million people in Scotland that have died so they’re underestimating
Even 250K wouldn’t even nearly justify it. I can’t actually fathom a value that would be worth these measures. Maybe 10% deaths all under 18s affected?
We wouldn’t need enforced lockdown for that, because people would do it themselves in the face of a real threat.
The sheeples do it in the face of an unreal threat. If the threat was real they’d all die of fright and we’d be well rid of them.
Bear in mind that some plagues (possibly smallpox rather than bubonic) wiped out up to 50% of the total world population of human beings about 3000 years ago.
Amazed this only has 173 views. Think I saw a shorter version on twitter.
https://www.youtube.com/watch?v=7iFp33KZwbE
A couple of interesting links:
https://hubpages.com/politics/Pfizer-Chief-Science-Officer-Second-Wave-Based-on-Fake-Data-of-False-Positives-for-New-Cases-Pandemic-is-Over
Not my words or Twitter account but the video is worth a watch:
https://twitter.com/artilleryvoodoo/status/1316491562168266753?s=20
Standard cult reply: “Well no wonder he’s their former chief science officer.”
Seen on FB, a quote attributed to CS Lewis “On just the same ground I dread government in the name of science. That is how tyrannies come in”
His novel That Hideous Strength explores the results of such government. Police can do what they like (mostly inspired by the perverted sadism of the female police chief), justice is bypassed, the media muzzled, population terrorised and under curfew, intellectuals brainwashed, etc., etc. And it happens worldwide.
In the novel, it turns out that the whole thing is a (literally) diabolical conspiracy. That, of course, is a fantasy.
Er…
Wishful thinking exercise …..
Which name popped into your head?
General Galtieri. That’s one of us being
disappeared into the Atlanticsent to a rehabilitation facility.Begins with H or W, depends on the mood?
Milk Tray?
Dozens.
The moment for change is now
World Doctors Alliance
https://www.youtube.com/watch?v=dVZQCsvPvsM
What a utter fucking Twat.
https://uk.yahoo.com/news/danny-dyer-coronavirus-055209146.html
“I think there is some sort of intervention. Something has to change, something has to shift within our human behaviour. And hopefully, on the back of this pandemic, something will shift within us.”
This is not an untrue statement in and of itself. But considering its messenger, and the overall context of the article, your assessment is spot on.
Obviously wasn’t around for HIV and AIDS in the 1980s then
Our dear friend Dr. Fauci certainly was.
If he means we should reduce government to one hundredth of what it is i’m on board, somehow i don’t think he means that though.
Yet another so called actor / celeb , or whatever you want to call them , that turns out to be from an elite bloodline . that talentless Mockney Twat didn’t get his fame and riches by accident . Just there to mouth the talking points handed to them by their neo liberal masters like all the other dum dum actors , footballers etc , paid goon shills of the establishment .
Watch him on who do you think you are.Funniest thing I’ve ever seen
I was just talking to Pontius Pilate on Twitter and he said that they never crucified Jesus, he died of Covid but after three days they give him an injection of Vitamin c and now’s he’s alive and well and living in a cave with a rock in front of it for 14 days until he’s safe to ascend to heaven
God tested positive and has to self-isolate for 14 days. Which considering he is omnipresent is going to be rather troublesome.
St Peter on the gate taking temperatures is resulting in many more people going to hell. Thank christ i’m not christian and instead have opted to be a Mormon. In their bullshit religion when you die you get your own planet to live on where you get to choose any woman you like to populate it with. So i’ve chosen Keely Hawes, i’m not sure how she feels about that but it’s my planet so she’ll just have to learn to accept it.
Planet Mormon, wasn’t that a musical doing the rounds in the old normal?
I got chatting to a Mormon girl in a bar in Portland, Oregon once. She was gorgeous, but weird. I forget why she was there.
Since you were in a bar i reckon she was there for a drink and maybe some casual sex.
I did all the drinking. And she left long before I had completed my beer tasting for the evening.
Probably for the best. You might have woken up twenty years later married, fat, bald with three kids and wished you’d stayed in that night
Instead I wake up 5 years later fat, bald and single in a war for the future of humanity. Plus a good knowledge of a variety of NW Pacific Coast craft beers.
Knowing a good beer is a skill worth having. If you’re ever over here in Albion i’d recommend you try a Pint of Batemens XB. The finest beer i have ever had the pleasure of drinking too much of. These days i can’t drink because i can’t be bothered with hangovers but on the odd occasion where i do it’s Batemens all the way.
Thanks for the tip, it’s a Lincolnshire beer which has not made headway in The Beast City (of London).
There’s a bad atmosphere here, this is absolutely one of the global hearts of darkness.
Plausible
Witty and Vallance say it’s just a projection, not a prediction.
https://dilbert.com/strip/2020-10-14
I saw a battle between a commenter with your name and a complete douchebag under Will Jones’ mask article in the Conservative Woman linked above the line today.
If this was you, thank you.
Thanks, it was indeed, fairly consistent pattern of pro govt trolls on conservative woman who eventually get found out, then in a fit of alleged pique, delete their ID and all comments.
Seen it at least a dozen times this year
Armed Police to issue a fine for a Gym not closing in Liverpool today.
This is ONLY going to get worse.
#TYRANNY #RiseUp #SayNoToLockdown #NoMoreLockdowns
https://mobile.twitter.com/Uhtred___/status/1316450282855960576
Short video clip of gym owner manager standing up. He deserves listening to in my view.
What quiet dignity and strength this man has. No histrionics, just calm determination under the most extreme pressure. This actually gives me a lot of hope.
The courage to stand in front of those paramilitary police is emmense. Esoecially since this is an unprecedented situation where one quite real possibility might be that the strange behaviour patterns of those paramilitary force could get very agressive very quickly.
I do not consent to that policing.
My grandfather was a police officer. He would be appalled at what has happened to his profession. They no longer serve their communities.
I’m gutted we cremated my grandfather. We should have wrapped him in copper wire and put some magnets in the coffin. He’d be spinning so fast we would have enough energy to eradicate climate change.
Couldn’t see any police. Noticed some sort of sinister paramilitary force, though.
Yes, very much like a paramilitary now. They have become incredibly sinister and dehumanised – they seem to openly despise the public. Need the old style civilian style police back.
The Bearded Ones. They think it makes them look “so macho”, I guess.
Police involvement at this stage (Day 1) suggests the local council may not be going along with it.
The owner was widely shared on social media saying he would stay open. They were always going to go hard and make an example of him – they are after all bullies who enjoy making people submit to their orders.
Local council officers probably scared out of their wits.
He’s raised over £20k so far (over £10k in the past 2 hours alone) for his legal fees in fighting the fines. Please do contribute if you can. https://gf.me/u/y4qdig
I’m surprised the police in the videos are wearing masks. I thought the regulations said that the virus doesn’t infect police officers so they don’t have to wear one.
You can’t recognise an individual thug through his face nappy.
More censorship:
https://www.theguardian.com/technology/2020/oct/14/youtube-bans-misinformation-about-covid-vaccinations
Andy Pattison, manager of digital solutions at the World Health Organization, said that the WHO meets weekly with the policy team at YouTube to discuss content trends and potentially problematic videos. Pattison said the WHO was encouraged by YouTube’s announcement on coronavirus vaccine misinformation.
People should be very concerned about the censorship- why are they so intent on everyone having this for something what is obviously not very serious for the majority of the population? I heavily suspect they will cover up any resulting injuries and make compensation claims incredibly difficult. YouTube is now like a state sponsored propaganda channel.
Horah for censorship
Horah for expert-consensus
Horah for science
(obviously scientists who don’t agree are not “expert” scientists – mere novices who should not be listened to)
And WHO meets weekly with General Chee Wa Chang, head of the PLA’s Disinformation Unit.
What puzzles me about YouTube censorship is how limited it has been to this point. No more than 10% of the channels I have followed for many years have had any problems at all. All the off-message channels could have been deleted outright months ago.
Thats naive. They don’t just delete. They demonetise. They shadow ban. They have all sorts of tricks to restrict the free speech of the people they disagree with.
Which is why people like Vernon Coleman are switching to newtube. Also YouTube put links to Wikipedia pages under any video they consider to be a conspiracy theory.
Who doesn’t know that you can’t trust Youtube, Google, Facebook and Twitter? These companies are outright liars and censors. All they are doing is digging their own grave. They can never be trusted ever again. They’ve played themselves. They could have been platforms for freedom and liberty but instead opted to be left wing tyrannical monsters. It won’t end well for them.
They are not digging their own graves. They are securing their market position by deliberately removing the people who oppose their PC ideology from the marketplace of ideas.
Again you don’t know what you are saying. No one is making you use their services but yet you do and then complain about it. Mate you are the problem. You are a vegetable waiting on someone putting dung on your head because you don’t have the ability to grow your own life. You’re a fucking spastic mate dribblin pish out your mouth.
If you don’t know Tom Woods i highly recommend him on all manner of subjects but he has a lot of good stuff this lecture is well worth it. Can’t recommend it enough
https://www.youtube.com/watch?v=Xy3tP-BW5do
Also recommend subscribing to his mailing list. Obviously US-slanted, but some good snippets come through.
i’ve been a student of the Mises Institute for a long time. These guys should be listened too. It’s staggering to know that while they explain economics and liberty perfectly there are still utter morons who believe in socialism. The weirdo Bono on here for instance is typical of the type of know nothing types who think they are helping but are only enslaving humanity with their socialist bullshit. It’s like they don’t want the chance to live their own life on their own terms and instead demand we all suffer under their insanity
The Austrian School. Certainly interesting :o))
Got turned on to these dudes in the early eighties by my Economics Teacher (probably the best thing my private education left me with) and never looked back.
There are no free markets anywhere. There never have been. Even in the most innocent-looking markets you will find influence and power are being wielded. Are you happy with the media market we have today where You Tube, Facebook, Twitter , Google, CNN, MSNBC, ABC, Sky, Global News, ITV and CBS can all enforce the same PC-Left groupthink on hundreds of millions of people?
The one thing i don’t need is you deciding? You utter cretin. Youtube can do and say anything they like i don’t have to use them. I don’t use google, i don’t watch the BBC. It’s funny how people like you are utter cowards needing others to help you or worse you turn on people who just want to live from their own work. Dealing with people like you is like wiping a babies arse.
His newsletter updates are very good indeed, well worth subscribing to.
Excellent, thanks Biker.
If you’re new to this sort of thing get your ass over to the Mises Insitute, read Murry Rothbard, Karl Hess, Robert Anton Wilson too. I warn you though once you hear them there is no going back and you’ll wonder how on earth we’ve ended up with a society like it is when we’ve had people of the calibre of this showing us the way.
Just watched it, can’t recommend it enough, it’s brilliant.
DavidC
Excellent article by Tim Watkins In ‘The Consciousness of Sheep’ I think he sums the situation up rather well.
https://consciousnessofsheep.co.uk/2020/10/14/when-payment-falls-due/
Just has some prick on Twitter tell me the mortality rate varies around the world. I told him the mortality rate around the word is absolute: one death per person.
https://twitter.com/BorisIsShite/status/1316508647405559808
*Virtually shakes Nick’s hand*
Didn’t Trump say at the beginning of this that “people are dying who have never died before”.
New Bond film: You Only Die Once (Except Twice If It Boosts The Covid Statistics).
Starring Daniel Craig as Tedros Adhanom as Boris Johnson as James Bond.
He also quotes 7 million deaths from Covid.Frightening how stupid these people are
I thought you could die repeatedly from Covid.
And then you get run over by a bus and you’re a Covideath.
Better luck next time.
Does anyone think Sunak will quit first?
Could he be the first to actually say, “Fuck this for a game of soldiers”, and quit?
https://twitter.com/hendopolis/status/1316483807634173958
He appears to be a complete shithouse. Just like the rest of them.
Agreed, Tom; I’m not backing him
I notice he chooses his words carefully, talking about a ‘national’ lockdown. Boris just ups everywhere to Tier 3; Sunak then says that’s not a national lockdon, so I’m in the clear.
I still wonder if he’ll be first to go, though. Let’s face it, one of them has to quit/get sacked first. I think it could be him.
There isn’t a single one with character. All careerist politicians. I will be digging my MP out when all of this dies down (marginal)
The most sinister words I’ve heard in the last few weeks were said with dread by Sunak – “permanent adjustment” and “viable jobs”
and Sunak has been scattering millions/billions of taxpayer monies to organisations that have not and will not contribute to a more equitable society.
Maybe but he is all that stands between us and the economic oblivion that the 2nd lockdown will cause
He’s in the globalist camp. I doubt it.
I think they play games with us. Remember Gove was the one apparently resisting Masks in shops and then a day or two later they were made mandatory. We are clearly going into another national lockdown and I don’t believe for a minute it will only last two or three weeks. They are all criminals.
For the Chancellor to make such a statement then he has to go if they choose lockdown.
You are right about the mind games though
The Chancellor of the Exchequer is briefing against the government via The Daily Telegraph.
What happened to Cabinet meetings?
Maybe he felt he had no choice but to go public.Very strange times
It is mind games. I mean, what’s the difference between full lockdown and everywhere in Tier 3? Not a lot, it looks to me.
I agree there is no difference between tier 3 and lockdown.
But there has been murmurings before that Sunak stopped Johnson going for lockdown after the chuckle brothers graph of doom.We will know in a week either way
Parliament petition to stop gyms being closed due to spike in Covid.
https://petition.parliament.uk/petitions/333869
I’m a fat bastard, but signed anyway
In cyberspace no one can hear you gorge.
I’ve never used a gym, and used to despise gym users.
What strange bedfellows we make in the Covid War.
It’s roared past the 100,000 mark, so the lazy bastards in parliament will have to debate it.
Has the flagship sailed?Will it be the first of a fleet?
The Fact-Free COVID Dystopia – watch and share wide!
https://youtu.be/Xy3tP-BW5do
Remember “pockets of resistance” during the Iraq War (2003 version).
Nazariyah
I remember when all of this was fish shop adverts.
Aye, and you had to tap out your posts on tiny little phones with stubby aerials…ee, times were ‘ard.
I remember missing entire evenings with mates because I went to the wrong pub, and there was no way of getting hold of them to find out where we were supposed to be meeting. Give me that freedom now.
Yep, you’d meet some interesting people as you went from pub to pub searching for your mates!
Or try to contact them by pager with the operator screwing up your message.
2020 – the year the world went mad.
Covid crap and lockdown lunacy closely followed by BLM bollox with a dash of XR extremism – and all reported by BBC, Sky and ITV as though it was perfectly sane and reasonable. Er no – it ain’t.
2020 – the year the world fully revealed its madness for the first time.
At least since 1939-1945 (or 1945-present for anywhere in the world other than the rich Western nations).
Indeed – it didn’t happen overnight.
Cambodia 1975-1979 is one of the best historical reference points. Amongst the most upsetting exhibits I have ever laid eyes upon was the collection of skulls at a killing field near Phnom Penh meticulously categorised by the implements that were used to inflict the fatal wounds. All actioned by ordinary citizens, often to people they knew personally, under the influence of malevolent state propaganda.
I think a less bloody East German Stasi-like destiny would be where we are heading. Quite a lot of 70s leftists and academics found the DDR model attractive.
Not only that. At least one of them won the trust of dissentient East German colleagues on visits to the country, then shopped them to the Stasi.
And it couldn’t happen here.
Could it?
Wouuld your zombie neighbour split your skull with an axe if Wancock told the Beeb to tell him it would keep him, personally, from dying of Covid?
Your zombie neighbour has done everything else he’s been told.
And there are no human beings left in his world, only faceless, voiceless, soulless ghouls. No need to worry about killing them.
Someone else made the comparison with the US war of independence. We have quite romantic notion of people heading to Canada but it must have got really unpleasant to reach that point.
The Tines are reporting the Police are backing off persecuting both Darren and David Starkey.
They should never have tried to in the first place. Someone called Max Hill is the Director. From his photo he looks as gormless as Witty and Vallance.
Sturgeon will be rubbing her hands with Glee on this news..
This is insane.
https://www.dailyrecord.co.uk/news/uk-world-news/scots-not-back-normal-until-22844566
Yep. And when the vaccine kills all the front-line NHS workers, who do we clap for?
More or less confirming what everyone here was saying two months ago when Vaxiphoria was at its height and being promoted in all our mainstream media outlets. Yet again proving sceptics here have a much better take on reality. We knew the “vaccine before Christmas” propaganda was shite.
The vaccine narrative has been bewildering. In the last fortnight alone November 2020, July 2021, never. Obfuscation at its best.
Big pharma has never been subjected to this much public scrutiny. I get the distinct impression that this is uncomfortable for them.
Yes – excellent comment.
I observed a while ago that one of the few benefits of the Covid “crisis” was that it was shining a light on vaccines, negative vaccine side effects, vaccine trial methodology and the impossibility of avoiding vaccine side effects,
It wouldn’t surprise me if Big Pharma is getting cold feet and telling governments to soft pedal. They would prefer less media attention so that in x months’ time they can simply announce they have a safe and effective vaccine – cue national rejoicing led by ITV idiot Tom Bradby. That way the risks of vaccine don’t get any exposure.
I recently dug out my own vaccination booklet (remember the old orange 1940s format with handwritten entries and rusty staples).
The jabs I received as a child were, given the severity of the diseases against which I was being vaccinated, both proportionate and necessary. I gather that children these days receive many times more, and I am unconvinced that this is in their best interests.
Quite but if you read the mission statement of the Vaccine Centre based at thei London School of Hygiene and Tropical Medicine (the Centre is also backed by the usual Imperial College suspects) it gets even worse – you’ll see they want to vacccinate for EVERY disease and get the whole human population vaccinated! Insane! !
I have had two physicians in Ireland raise their eyebrows or comment something like, ‘That’s a lot of vaccines!’ when looking at my teen’s vaccine records from the US.
I reckon the same applies to Gates and his globalist friends.
We ssee them now, and find them wanting!
“…warns vaccine trial boss”
No vested interest there, sounds like a trustworthy chap.
I shall write a letter to Mr Boss and ask him how things are going.
Just tried to find out who Mr Boss is, and came across this…
https://www.ovg.ox.ac.uk/team/andrew-pollard
I love the way the child looks all fucked up in their logo…
Love is probably the wrong word, maybe “it scares me” is a better phrase
It will be junior workers in care homes that will be pressured into taking it first but the side effects may not present themselves for years.
Honestly, looking at the trial designs and the FDA approval requirements for a vaccine, I think next summer is optimistic.
I assume the MHRA wouldn’t be more cavalier in its approach to safety & efficacy vs the FDA of course, and that may be a mistake. FDA is considered to be the gold standard globally, for all its faults, and for good reason.
Essentially an early approval would come from an interim analysis of the trials. And they want to see a certain number of severe cases of COVID in the placebo arms. Which would equate to 10-20pct for most trial designs at the IA stage. But as we all know (1) there is not that much real symptomatic COVID around (2) no way is 10-20 pct the proportion of people who get it severely. It’s more like 5pct.
So you’re looking at another 6 months of data to get enough cases, and all the time the herd immunity is building so it’s harder and harder to catch it (I mean properly catch it, not just a positive PCR test)
Hope this hasn’t been posted before.
Rare private interview with Boris Johnson on lockdown measures
https://www.youtube.com/watch?v=POBh4ErvOhY
Excellent thank you. Please repost early on tomorrows page to give everyone else a laugh
Test and Trace consultants paid equivalent of £1.5m salary
https://news.sky.com/story/coronavirus-test-and-trace-consultants-paid-equivalent-of-1-5m-salary-12104028
No wonder they can only afford to pay newly redundant ballet dancers and waiters £86 a week.
F*ck! Now that I’ve lost my job as waiter, I was going to retrain as a ballet dancer.
Do your feet know that yet?
No, no, that is not the official narrative – you must do cyber! /sarc
‘Flat earthers, ant-vaxxers and mask denies are not with the science and I’ve had it with them’
Bill Nye science.com
Guess what Bill , we’ve had it with you
It’s a beautiful conflation, in one sentence, of the weakness of the system against which we are fighting.
I have seen Bill Nye at close quarters, and he exuded a curious mixture of nothingness and malevolence. It only took a few seconds passing him to know his essence. A completely empty being.
We have nothing to fear from things like this.
Yeah, I have a friend who met him at a science bowl thing about 22 years ago and said he was an asshole. Even back then. He’s worse now.
Your description matches how I felt on passing Alistair Campbell at an airport. Malevolence and emptiness. Living in London it’s not unusual to be at close quarters with well known people. I never got that feeling with anyone else apart from Campbell!
Blimey, I spent thirty years in London but the nearest I got to celebrity was being ignored by Leslie Crowther at Alexandra Palace.
To my astonishment Stephen Fry also falls into this category. He walked past me and a group of mates outside a pub near Charing Cross in 2016 and his mere passage killed the drinking atmosphere stone dead for at least half an hour.
I had the same feeling when I saw George Osborne at an exhibition at the V&A around 2-3 years ago, I don’t like politicians of all stripes but there was something about him that just made the atmosphere rather deflated.
Also made a face at him, dunno if he noticed or not.
Unfortunately we are governed by things. like that.
Most celebs are empty vessels with not much going on between their ears. They’re all ego.
Nye is such a prick. Fuck him.
“Prick” denotes that he has a discernible character. He has no such thing. He is an errand boy, a messenger, for his paymasters. Nothing more.
I like ‘ant-vaxxers’. Fiddly job, though..
Someone’s got to do it. A nation is judged by how it cares for its arthropods.
A thoroughly depressing day.
France announce curfew,London and most of the north to face harsher restrictions with second lockdown looming.
Those who still naively think this is about a virus or incompetence need to realise what we are up against;a global co ordinated coup to enslave us and usher a dystopian green future.
I have been strangely encouraged today. The Scouse (or was it Wirral) gym owner fighting back calmly against being closed down, under enormous state pressure, is significant.
This is how we get out of this. Individual acts of resistance. No leaders, no organisations required.
It’s a nice dream but we are hardwired to follow and organise.We can only win if we unite.Individually they can destroy us as they will do to this poor man.
He’s fucked if he submits and fucked if he doesn’t.This is what totalitarianism does to the individual.
By the way a second lockdown will probably bankrupt me through lack of customers
The psychological warfare is unfathomably perfect. Isolate us, then allow a partial relaxation of the isolation on the condition that you comply with new (antisocial) behaviours. Then encourage attacks on all those who question these policies. Then blame those who disregard the regulations for their reimposition.
The second lockdown makes little or no difference to my life at all, but I am irrevocably against it, and will continue to communicate this to any person who crosses my (digital) path every day.
It’s only when enough people feel they have nothing left to lose that it becomes dangerous for those in power. I’ve seen enough of how police, councils, NHS grind down those who dissent to know that standing as one or two lone individuals against them is just pissing in the wind.
Yep.
That little shit Khan is pushing for London to go into the ‘high’ tier, because Mr Khan said the rate of infections in London was “fast approaching” 100 cases per 100,000. So, one in a thousand, or 0.1%.
Recent London figures:
In hospital: 389
In ITU: 77
Daily deaths for last 7 days: 1, 4 ,5, 3, 7, 5, 5
For a population of 9.3 millions
He calls that a crisis.
I call him a knob!
Edit: of course, I should mention that none of the above ‘official’ numbers are true, all exagerated.
Knob with bells on and he isn’t even legally the Mayor.
Dr. Khan wants Sharia London, with masks at all times everywhere, and no alcohol.
We are so weak down here that he will get away with it. I would like to think until May 2021, but we all know elections are a thing of the past.
He’s never cared about London – busy posturing and sticking his nose into affairs that don’t concern London but can’t be bothered doing his actual job.
He’s already bringing London to its knees as both the City and the West End are ghost towns now.
And now he wants to kill off the capital.
Perhaps we should petition to hold the elections now. As the lady from Save Our Rights UK has told me, they still carried on with the elections when the Spanish flu was raging, what makes this different?
Calling him a knob flatters him!
Another brainfart
I can’t remember where I heard it, but seems quite appropriate…
“Think of the average person in terms of intelligence. Now think that 50% of people are of lower in intelligence than that – shit we’re in trouble”
Well, we’re not. 50% of people are cleverer-rer than the average person. There are some extremely thick people and some very very very clever-rer ones.
Even the thick people are working out that this is a bunch of crap (or maybe they knew that all along and the clever-rer-rer ones are just catching up, and the clever-rer-rer ones always labelled the other ones as thick anyway, so never listened to them)
I recommend using childish insults and being aggressive towards people to win them over not.
(By the way, the establishment says I’m one of the clever-rer-rer-rer ones, I’ve got a 1st class degree in AI, so you must bow towards my opinion. I’m not arrogant about it though)
The late, great George Carlin — ‘Think of how stupid the average person is, and realize half of them are stupider than that.’
That’s the Guy!!! Thanks! <fucks off to you tube for a bit if they haven’t censored him yet/>
I’ve said something like that to people worried about taking their driving test
‘ Think of the stupidest most cack handed person you know who has passed their test.. ‘
Don’t go crossing the street at exactly 10pm where I live, almost got ran over earlier, nearly another Covid-19 death
Although we are going into a second national lockdown, there is a difference with March. Back then, there was unanimous and zealous support for the measures. Now, at least 1.0% of the population are genuinely questioning this approach.
1.0% are committed and about 49% are questioning but follow the herd mentality of the other 50%.
I remember travelling overseas when the Falklands war kicked off. Before I left, Argentinians were friends and trading partners with close cultural connections. When I returned after a few weeks all 50 odd million Brits (or 99% of them) hated every Argentinian and vice versa.
Our problem now is not herd immunity, its herd mentality.
The lingering tabloid hatred of Argentinians persists to this day. Totally unjustified of course. But we can learn a thing or two from their experience of being raped by external, hostile forces.
Maradona is the most gifted footballer I ever watched live (albeit on TV). What he did in Mexico was pure magic. All our imperfections and all our brilliance condensed into a few minutes of a game of football. And he came from nothing, the shanty towns of Buenos Aires.
Can’t agree with you on that, most people I knew were well aware of the difference between the Argentines and their regime.
When in holiday staying with friends in Milan aged 18 I was surprised to find them pro Argentina but not in a way hostile to me.
I had an Argentina football shirt in honour of Ossie and Ricky all ironed and ready to wear the next day to the FA cup semi final when I woke up my Mum had thrown it away saying it was to dangerous to wear it grrrr
I’d say it’s 50/50 where I live, for/against lockdown.
No, I think they’ve pissed on their chips putting places that we living fairly normally back under rules of 6, 10pm curfews, and now for us, tier 2 no mixing indoors. Friends of mine who were sticklers the first time are looking around months later and going, I don’t know anybody who has had it, I dont know anybody who has died, I dont know anybody who knows anybody who’s got it – and we’re tier 2, very high risk?!? WTF!
It doesnt help that the weather had turned crap as well. Local hospitality is offering a bit of a dont ask, dont tell policy on “mixing”
As this is akin to war, can´t we just draft the elderly and vulnerable to fight this for the nation?
The Volkssturm option has already been tried. It failed, along with the necrotic regime that enforced it.
I wonder how many teachers are encouraging pupils to grass up their parents for illegally inviting Auntie Gladys round for lunch.
How many have been brainwashed by Common Purpose?
Unlikely that more than 0.04% have ever heard of it.
This week Matt Hancock condemned experts who dared question lockdown. Now, after two of them embarrassingly exposed his basic errors, Prof ANGUS DALGLEISH asks… How IS this petulant, shockingly ignorant minister still in a job?
https://www.dailymail.co.uk/news/article-8840965/PROF-ANGUS-DALGLEISH-Matt-Hancock-survived-axe.html
Kenny Dalglish: Yes
Health Secretary: No
Pools panel predicts away win
Jellyfish McSavaloy comments
‘He is doing a fantastic job, so is Boris. Thank You. National Lockdown Now.’
Worst voted 23-257
Wind up of the day ?
“Fuckdown” is better.
Or maybe: “State-Fucks-You-In-All-Holes-And-You-Pay-All-Fees.”
We picked up on the scientific inaccuracies on here, although it’s nice to have it confirmed. I did put it as a comment on a BBC HYS and the one reply I got was an incredulous Really?
Hancock has the face I couldn’t get tired of bashing!
Scott Atlas: Prolonged lockdowns a complete disaster:
* Working class & low income people destroyed
* 46% of cancers not diagnosed
* 50% chemo appts missed
* 50% missed immunizations
* 200K missed cases of abuse
* 25% of young people considering suicide
https://twitter.com/justin_hart/status/1316381998345146369
Crime against humanity
It is!! I’m wondering what would it take to get people on the streets!
Is the ‘cure’ worse than Covid? Driven to despair by lockdown, two of Professor Angus Dalgleish’s colleagues took their own lives… and compelled him to join a growing rebellion against Cromwellian restrictions
Cancer specialist says he has been lost two colleagues to suicide in two weeks
One ‘killed himself as result of profound despair at loneliness created by Covid’
Prof Angus Dalgleish says focus on Covid-19 is ‘distorting healthcare priorities’
l
https://www.dailymail.co.uk/news/article-8824833/Lockdown-despair-drove-two-Professors-lives.html
Article in the Guardian:
National Grid warns of short supply of electricity over next few days
System operating at reduced capacity due to low wind speeds and unplanned power plant outages
https://www.theguardian.com/business/2020/oct/14/national-grid-warns-of-short-supply-of-electricity-over-next-few-days
Pretty sure I predicted early on that you couldn’t have half your workforce ‘self-isolating’ and many of your parts suppliers going out of business, etc. and not end up in a situation where your systems began to fail. Having also gone ideological and ‘green’ and banked on wind power is the icing on the cake.
Low wind speeds, who could have guessed that might happen?
and the solar panels dont generate so much because, unbelievably, it gets dark earlier .
Yes, the sun has to self-isolate every day under Tier 3 rules
My CT aunt predicted this a few weeks ago. California have been having power cuts for months. It seems to be another way of grinding us down.
Ping ! They knew this was going to happen all along.
All Tier 2 zones to go full lockdown at 17.45 this evening in the fight against the evil worldwide Pandemic.
All household in such areas to be permitted up to 20 kWh of leccy, to be reduced if you don’t behave.
(Now you know what those Smart Meters are really for).
And they’ve been forcing people to go over to induction hobs rather than gas, and they’re banning gas boilers in new houses from 2025..?
Which is why we refused to have them
New restrictions mean that only six people will be allowed into Wales. (Source: The Daily Hero)
Nicola Sturgeon will be using giant catapults to hurl Covid infected bodies into England.
Daily Mash.
I get all my opinions from The Daily Hero and The Daily Mash. The only unbiased newspapers out there!
I’ve just heard on R4: “Lockdown sceptics have lost the argument and should go back to their drawing board”
Oh well, that’s that then, we are all wrong
PS: A previous report reported fears of DESTITUTION!!!!
Now, where did we put that bloody board?
Who said that?
I don’t know, I only just heard the end of this report but no doubt, it was some “expert/experts.”
I will try to access it on BBC Sounds later.
PS:It was just after 6:30,news headlines,perhaps?
PPS: Today programme.
Dammit. I hate it when I lose an argument, but if it was on the BBC it must be true. I suppose I must be wrong, then.
As a great defender of the BBC, I sadly have to agree, but to be fair, apart from Talk radio, all the other media tv and radio stations including Sky seem to follow the same “Mantra”
Well if we have lost the argument then I guess there’s nothing for it but….if the BBC are saying we have lost the argument, then we are beginning to have an effect.
The BBC acknowledged there IS an argument?
BBC in shock admission that other positions exist other than narrowest ideological standpoint of all time which they have fully occupied?
Shit! We were wrong all the time! From now on I’m going to mask up, leap into oncoming traffic to maintain the two-metre distance rule, and carry an OS map with me at all times to ensure I adhere to the local county boundary restrictions. Sorry for being a naughty boy these past 8 months.
Did you see this, Mr Dee?
If they call month after month of slam dunk evidence, growing dissent and constantly being proved right, “loosing the argument”, they really are lost.
BLOODY hope so.
We’re still arguing, so we probably never received the memo. Did Toby mention it in an update?
Don’t know I’m afraid.
The Great Barrington Declaration is only 2,400 signatures away from half a million.
What can we do to get it over the line?
I’d send the link to my friends, but I’m a sceptic so I no longer have any.
Remember Comical Ali? You know THEY are losing the argument when they come out with stuff like that. Sunak, the most sane (and most popular with the voters) member of the Cabinet has come out openly against lockdowns. Language couldn’t be clearer. They are going to be fully on the run soon. Always predicted late November/Early December as dam break time. Still believe that will happen.
Tier 3 = Lockdown of Mass Destruction
In my newly conservative, formerly safe labour seat (the previous incumbant pissed at 10,000+ majority up the wall by being a staunch remainer in a firmly brexit seat, before flirting with Chukka Ammuna and Anna Soubrey, then fleeing into the arms of the lib dems), we have been put in tier 2 despite staggeringly low local death rates. The sentence I heard most yesterday? “And Boris can fuck off!”
Boris can fuck off is said repeatedly in this house too.
Ours too, but it wasnt just me. It was my auntie, 2 friends, a waitress, 2 people chatting in Spar, old couple waiting in the rain outside the butchers. Patience has worn very, very thin.
When your 2 i/c comes out against you, the writing is well and truly on the wall.
Yep
Late November/early December is crunch time as that’s when the end of furlough really starts to bite. There will be loads of job losses and bankruptcies in the run up to Christmas.
It really baffles me why the government is impervious to the economic Armageddon that’s to come.
I think it’s heads in the sand. Fingers in ears and singing “la la laaa” in a loud voice so they cannot hear you.
“Wine is strong, a king is stronger, women are even stronger. But TRUTH conquers all.”
Book of Esdras
It can only be a planned detonation of the economy.Business who are part of the green new world will be given help to survive.All those wicked carbon emitting firms can go bust.
Who cares about the devastation it causes,we are building utopia
Possibly why the major high street chains are not fighting back – they could have been bought off.
Definitely the cultural and heritage sectors have been bribed with the culture fund hence why they’re not following Van Morrison’s lead.
However someone still has to tell them that the money won’t last forever and the state will demand a payback from them as there’s no such thing as a free lunch.
When the GBD is over a billion signatures, and the BBC still describes it as a conspiracy theory, then I will believe we have reached the tipping point. Which is when the war really starts.
Until such time, we keep chipping away at their foundations.
When it is over, what will become of this site? Perhaps, together with a few other examples, it will be held up to schoolchildren in the future – “this is where the resistance began, children”.
So long as it isn’t held up to say “this proves that resistance is futile”.
I for one will miss seeing yours and a few others’ names on here. Sigh.
Aww, thanks
I was just thinking the other day that, much as I’m looking forward to the day when this site is completely unnecessary, I’ll miss it anyway.
Me too
If Covid-19 is eventually relegated to its proper position in the health care stakes and we start to clear up lockdown debris, there will still be a cohort of Common Purpose that has been parachuted into positions of control that will need to be ousted. (UKColumn has been flagging this cancer for many years.)
We shall then need, for a start, to instate a real ‘New Normal’ with true freedom and equality with full accountability from our PUBLIC SERVANTS.
Things are really bad:
‘NHS leaders say that so many patients arriving in A&E need admitting that they are running out of beds. Hospitals were well above the 85% bed occupancy level considered safe, with a national average of 91.7% last week.
Professor Derek Alderson, president of the Royal College of Surgeons, said: “That many hospitals have full wards, even after cancelling operations, shows that we simply don’t have sufficient numbers of beds in English hospitals.”
Apologies…that should read: …..things were really bad…… in 2018
https://pnhp.org/news/nhs-strains-under-flu-epidemic/
SARS-CoV-2 is the political gift that keeps giving for this government, PR cover for both brexit and the usual state health provider PR nonsense…….of course beds are always short in winter if you use central planning (modelling: always wrong) to predict bed requirements, just like centrally planned school places are always at a premium in good state schools.
The price will be paid by the citizens of ‘Democratic’ Socialist ‘Big State’ Britain and they will take their revenge on conservatives in parliament and local government across the land just as soon as they can.
Yes: ‘a hard rain is coming’……..another very long electoral winter for the conservative party….a ‘Major’ winter……..
Same in January 2020
https://www.independent.co.uk/voices/matt-hancock-nhs-funding-hospitals-accident-emergency-targets-a9309956.html
…. maybe This was his only way to reduce waiting times
This sums up the lack of thinking among the general public right now. Our local hospital is under stree right now, I think that is without doubt. They’ve issued a request to stay away, unless you’ve got Covid o course. Immediately when I saw people sharing this across Social Media telling us all to wear a mask, I just googled the same capacity warning and found it was also issued in January this year, late 2019, 2017 and 2015. That was just the first results that came back.
If anyone asks you to be scared of the boogey man, wouldn’t you want to just peak outside first to see? It’s so pathetic.
Our hospital is having capacity issues due to nosomical outbreaks closing wards and staff isolating. Yes, seasonal challenges but coupled with the staffing problems, it’s difficult. This is almost nothing to do with people not following rules or wearing bloody masks.
24 people have died with CV-19 in a ward of 300,000. 80% are over 80. There are tonnes of cases but I calculate the local CFR at around 0.72%.
It’s insane stuff
Keep repeating 99.86% survival rate wherever you post on SM. Most effective message by far. Anybody brave or stupid enough to engage from the other side soon gets short shrift in my experience and has very weak arguments.
Together with the fact that the hospital fatality rate is basically the same as flu
“Comparison of influenza type A and B with COVID‐19: A global systematic review and meta‐analysis on clinical, laboratory and radiographic findings”
75K with COVID‐19 infection, 113K with influenza type A and 9K with influenza type B analysed
Case fatality rate of hospitalised patients
* with COVID‐19: 6.5%
* influenza type A: 6%
* influenza type B: 3%
https://onlinelibrary.wiley.com/doi/10.1002/rmv.2179
Yes all that data is great for ensuing debate and conversations but rather than frame it as 0.14% IFR which many don’t really grasp, it is far more powerful to say 99.86% survival rate. Powder is left dry so that you can then say, pretty much 100% survival rate amongst under 60’s, average age 82, comorbidities etc etc. Genuinely have had a lot of people respond with ‘is that really true?’ and others saying ‘wow, I don’t know what to think anymore’ and suchlike. Toby if you read these, I would strongly advise to hammer this message as much as possible. It also has the resounding benefit of always being true, no matter the number of admissions or deaths ‘with Covid’ on any given day. It is also likely to move gradually in our favour too as more younger people get it and treatments improve.
I’ve posted it before, but it bears repeating. If you are under 40, your survival chances are considerably better than 99.86%. The age-stratified chart of deaths in the UK is quite revealing.
Can I use this chart, please? (SM postings)
All my stuff is up for grabs. Use it in good health.
You might not want to link to baffledcow.com though. If the norms see my posters, they will probably disregard the facts on the basis that I’m a sceptic.
Probably better to copy the full-sized chart and just paste it wherever you need. There’s also one of deaths-with-positive-test vs all-cause deaths that puts the relative risk into very clear perspective.
Thank you!
With a survivabilty rate of over 99%, this Covid thing clearly escaped from the lab before it had been sufficiently tweaked.
Novichoc is a bio weapon. You can survive from expose to it if you put your mind to it, or as PHE said use baby wipes and dry clean your clothes. That mocks bio drills armed forces are relentlessly trained in and injected for – remevmber Gulf War Syndrome. Perhaps these high security labs make puny pathnogens.
Novichok seems to be the most useless “deadly” nerve agent ever invented. So far, it has singularly failed to kill a single one of the people it was apparently supposed to, only managing to kill a homeless person after being discovered in a completely sealed perfume bottle. Despite this, those fiendishly clever Russians continue to use it.
The Magic of Novichok
Fentanyl killed that “Novichock perfume bottle” lady
Another day of our moronic MPs trying to outdo each other in the stupid stakes!!! Here we go again….
We are here and there’s no end
We keep on coming again
“If you aint with us, then it’s just bad news”.
Just woken up, is the pig dictator still with us?
‘fraid so Cecil
Very much so, I tried to drink him out of existence but I failed.
Dripford the Welsh Terrier is softly closing the border to you Englanders. A hard border is coming.
The Welsh have been told not to travel to parts of Scotland – why would they anyway? Scotland being a pathically lost country, with hills. Scots have been told don’t go to blackpool, nor to Northern England for pubs to watch the football. The devolved governments are merrily making their way to union break up under their fake stress of plandemic.
This Welshman travels to Scotland often in normal times. Usually the Highlands, but only two day trips to Edinburgh so far this year. For you-know-what.
Mandatory Woolly Masks for all English imposters. At all times, in all places, just for thinking these weird lands belonged to them. And I am Angle/Saxon, ich denke.
Do we have to quarantine if we need go into Wales?
That’ll be interesting. I take my dog for a walk across into Shropshire most mornings. She won’t like that rule…
I’m going to set up a people-smuggling enterprise for English tourists.
Last time there was a hard border was in the time of King Offa in the 8th century.
There’ll be no hard border:
https://www.walesonline.co.uk/news/wales-news/morning-headlines-police-chief-warns-19106188
Track and Farce has so far cost £60,000 PER PERSON.
I would have had a much more pleasant lockdown if they’d just given me the money instead…
I think the idea was that we have pissed away £60k per covid-vulnerable person. And these traitors brush aside GBD by peddling the lie that protecting the vulnerable wasn’t feasible – with a budget of £60k each???
£12,300,000,000 / 67,990,682 people = £180.91 per person in the UK.
I don’t know how many people are currently running the T&T app, so I cannot calculate the cost per active user.
Anyone know what Build Back Better means? Any details, Johnson just keeps saying it but then looks blank.
It means the opposite of what the words say. Double-think.
Lock Down Herder
Build = Destroy
Back = Completely
Better = Worse
Another bubble burst, should have known
I heard Biden uses the same slogan.
The WEF have used Building Back Better for a long time, a global mantra, or brainwashing technique.
Not just that but community level groups just move into line lockstep. The new language is adopted almost as if it was always there, always understood
https://sluggerotoole.com/2020/10/13/build-it-back-build-it-better-nicon-health-and-social-care-conference/
Search “build back better” (with the quotation marks) on Google images and see for yourself. I was horrified at just how far it has permeated in other areas too.
Just an empty slogan methinks.
As empty as freedom is slavery
It means ignore everything the government tell you, support local and independent business and stop watching the news
That’s certainly better.
What’s not to like?
That is the most optimistic scenario I’ve heard for a while.
Probably means much the same as “Strong And Stable” that Theresa May beeped at anything that moved in 2017.
The May Bot
It’s a WEF slogan.After they have finished destroying the economy we can have a lovely carbon free one
Take a look at this. ‘Build Back Better’ appears all over the place. Pure coincidence I’m sure
…
https://www.youtube.com/watch?v=kuidQDI3ZqY
Reminds me of “strong and stable leadership”. Bland, heavily focus-grouped, optimistic, but without any substance or original thinking.
A sure sign that a government doesn’t know what its doing, is announcing long-term policies and big visions, without any ideas as to how to address more pressing issues.
For example, how does 100% windpower in 10 years time (even if that is a good thing to do) going to help anyone who is suffering today?
I think they have also announced large-scale house building, which is one of those policies which is regularly announced. It all feels very familiar.
There was a picture on here the other day. Used by other countries and organisations – must be part of the re-set agenda
I am appalled at the basic project management failure with all this talk of lock-downs, when I had a team of managers, if any of them had come up with a lock-down project based on this flimsy inadequate basis they would have had a flea in their ear and a spell on the naughty step.
Julia HB is currently talking about this on talk Radio, asking the fairly basic question, what would a 2 week circuit breaker lock-down actually achieve? Are our lock-down attempts going to make the virus go away or just slow it down. If it is just to slow it down what is the point? surely it just prolongs the agony.
In my view a real black mark against Hancock is that he is not doing nearly enough to develop and promote better treatments for people who do get serious Covid. The NHS is now doing much better at treatments and this seems a development area where we are most likely to get some returns for any investments we make. Successful developments of treatments is much more likely than any chance of a vaccine but I guess it does not sound so positive.
Treatment for those with serious cancer sounds like a good idea to me.
Davos coup/Great re-set, i have no idea, way above my pension grade!
If this is what is going on? What can we do about it?
If it is the virus and the lock-downs then we can raise reasonable logical objections and suggestions.
If it is more than that then are we looking at open rebellion? I rather feel my Che Guevara days are behind me now.
A handy video about the Great Reset..Hey, they even have their own fucking website telling us how they are going to fuck us, but the people are still asleep
https://youtu.be/O31AfWoBfaI
Dave Cullen on the nail again. I expect they can’t believe how docile most people are. Planning to put the rest of NW England into tier 3 already.
Track and Trace has cost £60,000 per person here in the UK. Imagine if that had been spent on developing treatments? Better still imagine if it had been used on developing treatments for cancer and/or heart disease? ‘But, but covid?’ I hear the zombies say…
Yes, definitely sounds like the right track. Actually that sounds like a good deal more positive than the somewhere over the rainbow vaccination game.
I think the problem we have now is that everything is managed by “PROJECT MANAGERS” I had a job once as a project manager, the worst job I ever had, and the last, really. I was there to take it in the neck instead of my boss. Isn’t that what all project managers are for?
What really P××××s me off is when us sceptics ignore the more and more bizarre instructions that are issued almost daily, we are told: “YOU’RE JUST NOT LISTENING” as if we are as “thick” as the collaborators,sheep,maskateers,etc.
NO, we think for ourselves and make our own decisions, whatever our political persuasions.
I take pleasure in the horrified look on the zealots faces when I tell them that I disregard practically everything this stupid government tells me to do. Might aswell make it well known now.
Just going over the “Co-op” proudly sporting my “No lockdowns/We want freedom” badge.
Hope I come back with all of my remaining teeth.
Philip, you’re a hero.
No Ann, I’m not a hero, in fact I’m a fully paid up coward
Still got my teeth by the way, Ann, I honestly think that the majority of people have been that “cowed” that if I walked down our high street with Bojo’s severed head in one hand and a meat cleaver in the other, I don’t think that 50% would even notice.
Always a pleasure to read your comments, Ann.
Thanks for that and best of luck to you at your place of work.
We must stand firm, now more than ever.
Hmm.where could one buy such a badge? Is there a website?
It was from Amazon; £2.89. post free.
Where do I get one?
See my reply to Thomas E.
When this subject comes up, I laugh and ask in mock disbelief: “You’re still following THAT load of old bollocks??”
What pisses me off the most is when we are called selfish and Granny killers.
Janice, this is how stupid all this is, because my wife and myself are almost 72; if my grandparents were still alive, the youngest would be 121.
Seriously though, at my and my wife’s age, we have “what?” with a bit of luck another 10 years of (hopefully) active life.
I cannot understand why people of our age are prepared to endure a “living death” and a “Non life” for the rest of their miserable lives.
I agree Phil, in the words of that marvellous man on the radio the other day, ‘existing is not living’. Now if I could only get that through to my mum and dad, mid 80’s. Can I say what a joy it is to come on here everyday and read and be part of LS, reading your comments and daily experiences not to mention trying to get my head around what some of you are saying. You are all so clever. While we in oz haven’t had it as nearly as bad as you guys I want to scream at the patronising of our governments and mainstream media.. At the moment our states and territories are like a different countries, we in NSW are not welcome. But I can at the moment go down to my local pool and swim and sit in the sun freely without agitation. Weekends are getting worse with the badgering of beachgoers who don’t sit a towels distance from each other for goodness sake. I am in no rush to travel interstate even when the borders are open I am so P’OFF. I have lost complete faith in our elected officials on both sides and despair for the future of our children and grandchildren.
Actually I quite like not having people breathing down my neck when in a queue or on top of me when at the beach or park.
Agree, and generally we don’t need to be told through a loud hailer. Which is what drives me crazy. No one usually sits on top of each other.
Many thanks for your kind comment GDU. I am certainly not clever, I left school aged 15, and I haven’t got a single qualification to my name, not even a driving licence.
To my wife’s irritation, I always say that “I started at the bottom and worked my way down.”
But like all sceptics, I can think for myself and if I see complete and utter stupidity, it is our duty to resist in any way we can.
Here’s the thing, Philip – I don’t think we are, but nobody’s asked us! I’m older than you, expect you too had measles, mumps chickenpox, whooping cough, scarlet fever before you got to secondary school. We sort of know that if we’re unlucky enough to get a respiratory infection, one time, our immune system won’t cope and we’ll die. That or something else will get us in the next 10-15 years. Meanwhile, we want normal life! Plus, we don’t want millions living hand to mouth in the 3rd world to starve. My impression is, there may be disproportionately many elderly and people with health problems on here, more than I would have thought in the beginning. Why? Is it just we have a better sense of proportion?
Maybe we recognise what our parents had to go through to maintain/achieve their liberties, that a meal on the table and a roof over our head was enough, no govt handouts etc we lived within our means. Perhaps the less we had in material possessions etc made us appreciate the freedom to move around without constraint. My parents grew up (we did to in the 60’s to some extent), with childhood illnesses that perhaps might kill. I think you are right Sylvie our sense of proportion is better balanced. Sadly though my parents seem to have lost this perspective.
I came from a third world country and my parents worked all the hours god sent them so we didn’t have a lot of treats, barely had any family holidays at all and they really sacrificed a lot for us.
They taught me & my siblings the following:
I think that’s why I’ve always been sceptical of this crisis from the word go. Something never added up.
What’s really sad however is that it seems that with this virus my family seemed to have forgotten the last bit of their life lessons.
Thank you for your kind comments.
Wonderful comment, keep up the good work.
Never had that but I’m 6’2 and wear Dr Martens.
If there was a real pandemic, with the lethality of Bubonic Plague, I would not advocate any changes to society. Let every individual judge the risk for themselves.
What we have here is the apotheosis of decades of weak mindedness coming home to roost.
I just finished 1666:diary of a plague year by Daniel Defoe. Civil society carried on as normal. They just stopped infected people (and their cohabitees) leaving the house for a month. But they were brought food. They didn’t send the dying into the houses of the vulnerable and then board them in like now
The awful truth, steve, is that all the “sheep” probably think that Daniel Defoe” was a BGT winner.
Come on, if anybody believes all this present “clap trap”, they would struggle to read the instructions of how to open a glass jar.
Or a premiership footballer
Of course.
Defoe also describes how everyone suspected that the true numbers of dead were being underestimated by the authorities in the official figures. It is probably the case for past pandemics that the authorities have wanted to minimise/underestimate the death figures.
With SARS-Co-V2, what is so odd and ghoulish is that the UK authorities (and possibly the authorities some other countries) seem to want to maximise/overestimate the official number of deaths.
Perhaps because fear is one of the basic emotions.
It’s decades of weak-mindedness and also young people growing up being told you can have whatever you want in life. For the first time this is a really hard decision that is happening now, not at some indistinct point in the future like climate change. So they think they can save everyone but still keep their job, have NHS there for everyone, go back to living as we were in a few months time. But we can’t. It’s not being callous to say we shouldn’t lockdown, it’s being realistic. People will die, either the very old and infirm or cancer, heart disease patients etc. There is no ‘you can have whatever you want’ with this virus but people haven’t yet realised.
Perhaps many people do not quite realise that freedom is their most precious possession. Given how many people have been prepared to die for it over the past centuries, it’s clearly more precious than life itself.
Hopefully people are waking up to just how precious freedom really is.
To be fair this is not limited to younger generations. I am pushing 50 and have never had to make any compromises or sacrifices for a wider social cause.
This virus does not justify the measures, but I have made small sacrifices to accommodate the impositions nonetheless. I have been aided in this regard by being antisocial and misanthropic. But I draw the line at masks and all that comes beyond this threshold. Hence my presence on here.
Precisely my position Richard, as key worker I am, and will be, able to work as normal and have enjoyed my own company of an evening for a decade or so. Likewise I draw the line with masks.
Listening to business on the radio, they are horrified at the thought of a full lockdown, but seem impotent against this Covid Cartel of a Government. 1600 people die every day from a range of diseases and a lot have died already from their covid policies, so can’t believe its the prospect of more dying of covid which is carrying this agenda.
There are more lawsuits on the horizon. The GoFundMe campaign for the legal battle by Save Liverpool Gyms has already raised over £25,000 since yesterday. I’m not a gym user, but I still gave them a fiver. Any like minded person should consider contributing to any legal challenges.
https://www.gofundme.com/f/save-liverpool-gyms/
If Dolan wins his case, the floodgates will open…
I’m not getting my hopes up for that after the courts’ brexit record.
Sherelle Jacobs a bit disappointing this morning.
This is a long game. The government can afford to play a long game.
We are minor players in a world dominated by the U.S.A., China and the eu
Our politicians will be led, mainly, by what happens in the U.S.A. and who wins the U.S. election.
Those of us who lived through the 1970s are in familiar territory. As soon as a system of government brings impoverishment, it is gone at the next election.
This time it is an opportunity for the labour party. If they can be ‘relaxed about people getting filthy rich’ again, they can have another three terms after this shambles…….
There are many people who won’t forget that Labour would have been intent upon impoverishing and restricting their Freedoms even more, see Starmer yesterday.
Exactly. I’m now a former Labour voter.
If you look at where sceptics are now, compared to when this site started, then I cannot agree with either you or Ms Jacobs. This is a long game and reality first bites in the stomach……
But the argument will not have changed in the intervening period so enough of the negative stuff….just an aberration on her part….
“This is no time to wobble, George!”
Various communications equipments about the place bear the scars…..
Labour is done, I am afraid. They are pretty much finished as a political party. The next election will be between the the authoritarian and the libertarian wings of the Tory party.
The left is long since destroyed by the effective demonisation of true leftist politics and the liberal left’s intellectually feeble obsession with identity politics. England is essentially a centre right country, always has been. The left was able to occasionally take power by getting buy in from a large working class. That class is much smaller now (or at least those who believe they are working class) and also utterly contemptuous of identity politics, so they are gone. The Islington-style Blairite “lefty” is too small a demographic, and the moderate left can’t forgive Labour for Blair
So, unless the Tories split to form a new party, get used to single party rule for at least the next 20 years.
Reality first bites in the stomach………
And economic depression brings many surprises, ‘interesting times’.
Except they have squandered their opportunity. New parties stepping up to the plate will have their chance at the next GE.
That’s if we ever get to vote again.
It is not uncommon in parts of central Europe to hear people of a certain age (and status) yearning for the ‘old days’ of the iron curtain….
‘You pretend to pay us, we pretend to work’
I look back on the 60s and 70s with great affection. We had plenty of freedom and jobs but not much money. Now we have no freedom, no jobs, and money in the bank but no where to go.
I travelled like a madman 2013-2019. 4 continents, 20 countries. People laughed at me because of this. They are not laughing now.
Same here Richard, same time period.
1970s. Colour telly, sound systems, Vauxhall Cavalier, rainbow tank top, Loons !
Remember, children, try not to use too many words in your story. For instance, instead of:
Ten people, who died in Wales from unspecified causes, had coincidentally tested positive for Coronavirus, at a time when the test, which has been proven to be faulty, is being used more and more, on people that simply don’t need it.
We can just say this:
Ten more people have died in Wales after testing positive for coronavirus while the number of positive cases has hit a record high, it has been announced.
(Wales Online).
The trouble is, people don’t read very much on the web.
If you show them enough text to do justice to the subject, they just won’t read it. Therefore every issue, no matter how important, is boiled down to a single sentence.
That’s why I’ve reduced “What I Believe” to as few words as I can. I’m not happy about having to play this game, but right now I’d rather compromise than lose the battle.
I’ve even dropped the bit about lockdown costing more life years than COVID-19, simply because I couldn’t make it short enough.
How about “Lockdown costs lives”
Agree. It’s irrefutable.
According to Scott Atlas, it was true as early as June, at least when measured in years of life lost.
And it’s the years of life lost that causes me trouble. It’s too long.
I can’t just say lives lost because I don’t have a source.
Totally agree, Mabel. You have to write/speak in ‘headlines’. In fact, the great unwashed don’t even read headlines – they just go off what they think they’ve heard in the headlines…
Hi Mabel, I completely concur.
Which is why I’ve always liked Swiss Policy Research articles such as this one:
https://swprs.org/covid-the-big-picture-in-7-charts/
Present the facts in verbal and visual form, and at the end, five short points:
I’m of similar position now, and if anyone calls me up on my short point(s), then I can give them a full blast of observational facts and peer-reviewed, international statistics, if I can be bothered.
And that doesn’t even include the ‘online’ cases and those who ‘identify’ with covid and therefore ‘have’ it. Plus any government fraud, sorry, ‘spin’, that is put on it. Agenda? Are you stark staring mad? The answer is yes.
https://www.telegraph.co.uk/politics/2020/10/15/lockdown-sceptics-world-must-unite-new-manifesto/
this morning in the Telegraph
Yes -it is very good though paywalled for those that don’t have a subscription. Maybe Toby can give selected quotes in his update.
Yes, please. Some idea what’s in it for those of us who don’t subscribe to the Telegraph.
Toby won’t like me saying but just disable Java Script to read the Telegraph articles. I keep a different browser with it permanently disabled just for this purpose but you can get plugins that do the same job.
Essentially it is saying the message needs to reflect the fact that while we think most people value freedom, they don’t – what they really value is feeling safe and feeling like they are conforming.
I have had exactly this discussion in the last 24 hours. I tried to explain that as safe as they feel from the restrictions I am by the same measure in hatred and terrified of the loss of freedom that has occurred. Maddening just doesn’t do it justice.
That’s how I feel too.
Essentially, sceptics have lost the first round of the argument, need to come up with different ways in getting the same points over… and all unite behind them in time for spring.
I honestly feel I won’t last that long. A heart attack or stroke from the intense and relentless suffocation from threat of further restrictions will be more likely for me. It literally makes my heart physically hurt.
You don’t argue. You endure and chip away. Things don’t breakdown gradually. The human ability to fool oneself is amazingly strong
An article of despair but given what happened yesterday you can’t blame her
I’m still encouraged. The idea that the govt isn’t following the science is false. Before undertaking the current measures from late Sep they consulted a wider group of scientists inc Carl Heneghan and Sunetra Gupta as well as SAGE. Both the afore mentioned confirmed this though, slyly the govt haven’t, which is not very clever. Heneghan in a BBC interview claimed that essentially we are now following the Swedish model.
Not up North we’re not.
I think she has completely mistaken the changing public mood.
I think so too – the idea we can come up with a single moment, like GBA, and win the argument in a stroke was always a non-starter.
We are fighting a very powerful machine designed to exploit a very established mind set in people.
You don’t beat that overnight, you persuade one at a time and you chip away.
Looking at comments on social media and in the press, we are much further down the line to sanity than we were even a week or so ago. We’ve just got to keep at it.
The government and press is having to lie and manipulate data more and more to keep their story going – all the time their story gets weaker and ours gets stronger because it is based on reality.
It’s tough; but patience and persistence is the only way to beat a bigger enemy
What depresses me about that is that she has missed the obvious issue.
The vaccine has become the new Messiah, and yet the experience of the initial versions of the flu vaccine show a clear issue – it won’t be very effective to start with.
It won’t be the Messiah. It won’t help the elderly who struggle to gain immunity from vaccines. It won’t do very much at all. The virus will still spread and the elderly will still die from it.
Unless it is a BCG vaccine:
‘In addition to the clear effect of BCG vaccination on infections in general, the most important observation was that BCG could mainly protect against respiratory infections: BCG-vaccinated elderly people had 75% fewer respiratory infections than the elderly who received placebo.’
https://www.news-medical.net/news/20200901/BCG-vaccine-offers-protection-for-elderly-people-against-respiratory-infections.aspx
Look, I can’t read the article, but I disagree with her first paragraph entirely (all I can see).
I don’t think the GBD is dead, nor do I think rivals had much success tearing into it, nor is the WHO’s pronouncement of Herd Immunity as immoral a killer blow.
A declaration radically different to the current government narrative is going to take time to bed in. Not forever, mind you, but we (skeptics) cannot continually slide between positions, declarations or movements otherwise we’re seen as a scientifically flaky lot, ready to throw our hats at any anti-government edicts. We must stay true and focused to an overriding point-of-view (even if we squabble on minor details), in my humble opinion.
And for me, the GBD is just that.
So far, Trump seems to have been implicitly influenced by it, or certains axioms within.
The petition grows in numbers.
Anecdotal evidence would suggest a healthier number of sceptics slowly voicing their opinions.
Or, I could be desperately clinging onto a shred of optimism whilst pondering the abyss? A bit 50/50
Cheers
Dave
Be careful with generalisations. Personally my life has been barely affected, but I am in excruciating agony every day about the darkness that has descended upon us.
Agree. I’m a civil servant and desperately wish this shit show would disappear.
What we really mean is our lives have not yet been materially affected. This will come very soon. Psychologically I’ve been crawling up the walls for 7 months straight, with at least as many more to come.
I’m 60. The first time I have ever experienced panic attacks was four weeks into the Lockdown. Wearing any face covering triggers further attacks. Thanks Boris.
Get an exemption card – I did and now my panic attacks are ‘only’ when I contemplate the destruction that is occurring!
Exempt!!
It’s easy to get an exemption card I bought one from Amazon.
Me too. And the economic impact is going to come with tax rises, pension being devalued, having to pay for healthcare as the NHS has shut up shop, etc etc etc
Ditto! Lot of people doing well out of ‘it’ in our department.
I’m comfortably semi-retired with a long-term WFH income. My income has actually gone up a little and expenses have fallen. But I still wake up angry every morning because of the impact on all of us.
You were lucky enough to wake up today. I didn’t sleep.
I haven’t had a good night’s sleep since an alcohol induced one Sunday evening. I’m even dreaming of lock down scenarios, conversations and masks! Gonna hit the whiskey later.
Perversely, my day-to-day life has greatly improved because of this shit show.
I can work from home, doing the hours that suit me, I don’t have to waste two hours a day pointlessly dragging my atoms from one place to another, and my pay has even increased (slightly) with a working-from-home stipend. I’m a solitary sort who rarely goes out. I’d like to visit my family back oop North, but the reality is that I never get off my arse to do it, so not being able to do it now makes no practical difference.
Psychologically, however, I’m a wreck.
My grandfather fought in WW2 and he impressed upon me from an early age the horrors of the Nazi regime. As a nine-year old, I was much affected by images of pits filled with corpses. I have been wary of the power of government-led hysteria ever since.
So I find myself in a twilight world, where things have never been better and yet things have never been worse.
I can’t imagine what this farce feels like to somebody who has really suffered, who has lost their job, business, house, or companionship.
Somebody needs to answer for this.
Not to gloss over the serious stuff in your post, Mabel, but “dragging my atoms” is bloody great!
Quite so: some days I feel near despair; other days I do despair. What a dreadful legacy is being imposed on the future.
I cannot see any politician out there that can break this cycle of gloom: apart from Mr Sunak. Johnson is more or less finished and Starmer is just more lock down and economic destruction. Sunak is the only high profile politician that can see the clear water of keeping the economy open whilst protecting the “vulnerable” – he is first in line when fatso falls. There is no other way i think, i did not want to support another banking type from the same school as Macron, but it is what it is now.
I agree. Sunak looks like our least worst option.
Unfortunately that all sounds like ‘Boris is the least worse option compared to Corbyn’… Sigh. Bring on the anti-politician and anti-scientist riots please.
Not all scientists are bad though…
As Mark says,it might be a next step- not suggesting it’s a solution by any stretch. At the moment I find the notion that vast swathes of the population will be rioting on the streets and that this will bring about the desired change as implausible as an instant political solution.
I can’t speak for anyone else here, but my fairly wide skill set does not include knowledge and experience of guerilla warfare.
Can’t you see that would make zero difference. It’d just be changing the window dressing. Same shop inside
Sunak is married into one of the richest families in the fucking world, so globalist scummbag all the way..False hope, there is nobody at the moment ..Plus the next election is in 4 years. All hail the God Emperor Boris! Build , Back Better..welcome to the New World Order
Short term, you’re right. Support Sunak to get the main perpetrator out and hopefully disgraced. Longer term, Sunak is one of the Guilty Men of the Lockdown Cabinet. Unless he makes a full mea culpa and promises to rule out lockdown as a policy in future, never forget, never forgive.
Honestly, if there was anyone else – i would be there.
Absolutely. My view as well.
Labour, the opposition that doesn’t oppose.
But why would they when we now have a socialist government?
They are opposing – but in the “longer, harder, and with full masks” direction.
Labour is a disgrace. They are instrumental in hundreds of thousands of people losing their jobs.
How many people has Boris killed so far?
Where does he rate on the British Prime Minister murder scale? Is he up there near or at the top?
I’m pretty sure he’s not doing so well in the world scale, he’s up against some big players like Pol Pot and Stalin but it’s early days yet. I’m sure that he’d look better if it’s worked as a percentage.
His mother must be so proud.
Cameron killed over 100,000 with his austerity package the BMJ estimated, I fear Boris will kill more in a shorter time.
Don’t worry. He and that scummbag Hancock will probably be knighted for this. Because if anybody thinks there will be any consequences for this , they are highly delusional at best , fucking naïve at worst. He is doing exactly what he needs to, kill the economy, get everybody on the Chinese style socila credit score, destroy everything that makes this country great..He is doing an amazing job.
Doing his bit for population reduction.
Do you think he might lead by example?
The funny thing is the people who complain about humanity and how there are too many of us, always believe that they themselves are indispensable.
Can’t beat Tony B.
Until the economy collapses and there is no money for pensions.
We have done that too. We haven’t received a reply yet to our request to reduce our payments on account but it’s October now and fairly obvious that we won’t be generating anywhere near as much revenue as last year and so we will be withdrawing so much less personally. We can just about afford the hit for now but it can’t go on much longer. No help of course, just a delayed VAT payment and personal payment on account. Both of which will be due in January. Tend to agree with your last sentence too, NN!
They keep sending me letters requesting a chat.That should be interesting.Have you got the money you owe.NO.why not.Because you have destroyed the economy.
Please don’t generalise. I personally may not have lost my job and am relatively secure financially but it makes me sick to the stomach what people are having to endure due to lockdowns. It could just as easily be me had I chosen a different line of work. This state of affairs isn’t good for anyone, and we are all losing out in some way because of this government. The government want us divided, remember that. We can’t let them turn us against each other. That’s how they win.
That’s true and that is why they have stopped more than 6 meeting up.
Haven’t actually seen this on LS but it should be seen, IMO
https://www.youtube.com/watch?v=DO4uZPeUqBM&feature=youtu.be
Note the scary YouTube disclaimer
Fundraiser for Liverpool gyms reached £26k in a day. They will probably need much more to pay all the fines dished out. Its pure madness to close the gyms especially in the winter months.
https://www.gofundme.com/f/save-liverpool-gyms
The fund raising is to fight the Fixed Penalty Notices in the courts, not to pay the fines. Plod can’t fine you – they can issue FPNs which you can pay or contest.
Thanks for this – I’ve just contributed and shared on social media.
Is that gym owner our next PM? Stranger things…
He’s got my vote.
Avi Yemini, a journalist at Rebel Media, has been organising a fundraiser to help people fight lockdown fines in Gulag Victoria, Oz for a few weeks now. I’m glad to see it’s beginning to happen here too.
My husband and I visited our local garden centre yesterday and decided to duck into the cafe while we were there. Big mistake, as they now only do table service and we had to wait 45 minutes for a coffee and a hot chocolate. Anyway…naturally the first question they asked was ‘Do you have the track and trace app?’. As if. So my husband filled in one of those pointless pieces of paper with his ‘track and trace’ details. Hehe. Apparently I’m married to Geoff Petunia. Just to clarify, last time I checked his name is not Geoff and our surname isn’t Petunia. Next time we visit it’s my turn. I was thinking of Hyacinth Bulb or maybe Rose Bush? Got to try and have some fun with all this insanity going on around us.
Mr Bart and I have decided on Adolf Hitler & Eva Braun. Individually I could be Jiang Qing.
Raymond Luxury Yacht (pronounced ‘Throatwobbler Mangrove’)
Seymour Butt
Hugh Jass
And I know a Joe King
Credit for that name goes to the Pythons, from whom I shamelessly stole it.
I’d go with Smith or Brown personally. If a lot of joke names start showing up on those pieces of paper, the powers that be will scrap them and make everybody use the app.
Ferguson – first name, Neil.
I think we should use plausible but incorrect names and phone nos. T&T success rates will drop and eventually the manual process will be replaced with app, but the more obviously incorrect names that are used the sooner that will happen.
Just make it look as though you are playing ball, whilst all the time subverting the system.
The authorities may penalise the establishment if they don’t spot obviously false details.
Yes. Gentle, plausible subversion of the system is the way to go.
I used Wayne Ker-Hancock…
love the names everyone has!!! i wonder if the staff every look at them and have a laugh…
In honour of Catch22 “Irving Washington” or “Washington Irving”
encouraged by a night out in student land in New Cross. In some respects table service was an improvement on the bar service. Some places couldn’t get in as they were too busy. Still one of the best pub crawls in London.
Is it just me, or has there been a subtle change on social media comments? A few months ago it was nearly all ‘obey the rules to save your nan’, now it’s ‘obey the rules so that we can get all this over as quickly as possible’. I do detect a note of annoyance and frustration creeping in amid the piety, which can only be a good thing.
Perhaps they’re realising that they’re losing the argument but can’t quite break ranks yet. Or are getting annoyed that more and more people are waking up and thinking for themselves.
or its a case of obey the rules now so that we can change them in the run up to Christmas. My money is on a review of cycle thresholds used in PCR tests and a general advice to use Vitamin D supplements with revised NDA for different age groups.
I expect Christmas will be cancelled but it’ll be our fault (as usual) for “not following the rules”.
Getting very well informed sceptic comments in the Mail, most of the worst rated seem to be spoofs.
Is it everyone from here going over there and posting stuff? I don’t post there.
I think it all depends who you follow…I know people who have actually doubled down on the whole Covid thing and to read their forums and posts…Whoa..the hatered they have for us sceptics, it’s nearing very closely to what the Nazis thought about the Jews…Very few people have changed their minds and the lines have been very clearly drawn months ago. I don’t even try to convince or even challenge anybody anymore as I have lost nearly all my friends and most of the finally think I’m crazy and need help ( my mothers words!!) At least my wife has woken up and now it’s all getting too much for her.The truth is just too bleak for most people.
Yes, back in April, if I had to quantify the observation, I’d say about 1 in 20 comments were anti-lockdown or sceptical … but the other 19 tended to be personal, fact-less, highly emotive attacks on the lone sceptic.
Now, if you order by “Top Comments”, it’s rare to find a single one in the first 20 that support the government’s criminal position.
Why doesn’t YouGov reflect this? Oh yes, my healthy scepticism would suggest criminal interference in votes, or a heavily skewed audience.
Twitter still seems awash with zero-risk, bet-wetting (oops, sorry), lockdown zealots.
Cheers
Dave
Yes Dave I am one of the fact less/ personal commenters on this site. I have truly enjoyed being part of this site and the awesome knowledge you all have. . I am not on fb, twitter etc. Strangely our govt website is called mygov, yeah right! Amazing how they know soooo much about you. Even now though, our morning shows are exhibiting some sceptism it’s coming through. Bring it on.
Love that your mum is watching sky news oz. What a techy legend. I wonder if that might have been Rowan Dean she saw, I watched it if it was about the reset. . I would love to know how elderly she is. I am 60, older/younger? Ha ha, you might be same age as my son who thinks I am an antique. Totally turned off with Charles and his ilk which came up in that report, though I love the Queen. Having said that now, where is she? Have heard nothing.
I’m going to demand a rebate on my NI payments as there is no health service to speak of.
Don’t forget the millienials who have swallowed the propaganda whole and always go “people before profit”
I think they will change their tune when they’re made redundant, can’t get a new job ASAP and that mum & dad can’t bail them out.
”In a time of deceit, telling the truth is a revolutionary act.”
Great Barrington Declaration has broken the half-million mark. Now at 500,079 signatures.
Woohoo!
All fake names of course…
Bound to be!
Fake names, given by far-right Covidiot granny killers with no respect for Our Wonderful NHS.
Our fantastic NHS.
Best dance routines the worls’s wards have ever seen.
Not as fake as ‘covid deaths’
500,080 now, I just signed!
The words: “A blight came o’er the land” came to mind this morning. The words come from the song “Skibbereen” which is about the Irish Potato Famine. Thinking of which puts the present malaise in perspective.
The impact of the famine could have been ameliorated had the government done more, whilst the impact of Covid19 has been exacerbated by the government doing too much – well, that’s my view anyway.
The Famine has parallels in that some “food” ie corn, was not allowed to be eaten. It was rent. So by not allowing tenants to become landowners they couldn’t survive. It’s also why some commentators say there was no actual famine. Which is true. It was an artificially induced famine.
By inventing rules to shut out parts of society it led to a million deaths.
This has probably been posted already:
https://www.dailymail.co.uk/news/article-8840965/PROF-ANGUS-DALGLEISH-Matt-Hancock-survived-axe.html#comments
How long can Hancock survive?
Wrote to my MP, who has twice voted against the government, asking him to seek Hancock’s resignation. Also to Graham Brady and Charles Walker.
This comment on that article/story
“Mr Hancock may well have fluffed the science, but that does not mean the Barrington declaration is not equally as ill informed. The fact is there is no substantial evidence that a sustained immunity to covid develops post infection, at the moment we simpoly do not know. But we do know that unchecked covid will kill betwene 1 and 3% of the population (mainly the old and those with co-morbidity). We also suspect, though again do not yet know for sure, that it has longer term impacts on the health of a significant percentage of those who are infacted. So adoptingthe Barrington declaration effectively states that we shoud, risk 650,000 to 1.950,000 deaths in th UK with the only protective measures apparently being “encouuraging the young to move” out of their home – one wonders what happens to the infirm relative relying on them for caring at that point or where the young are supposed to move? Sorry the Barrington decalration is a fiction.”
The above comment was copied & pasted from the Daily mail website.
Uphill struggle people.
Yes, but what were the likes / dislikes on that comment? I notice a very sceptical mood in the highest rated comments in the DM.
We need Guy Fawkes 2.0
I am praying, indeed prostrating, possibly flagellating, to any god that might listen.
As with the any papal election I am looking for smoke as confirmation…
If you just let a firecracker off near parliament at the moment, it’ll probably make all the buildings collapse. Is Big Ben still in scaffolding? I’ve not been to London for 7 months…
Ah now if it’s only one firecracker that we have then I know just the place for it: ‘bend over Mr Johnson’…
I’d rather it was a hand grenade though. Or a MOAB, yeah that’d do it. I wonder if Mr Trump might spare one, it’s for a good cause after all…
I’d have thought an Uzi 9mm would be more your style.
Any one of these is ideal for political opposition.
I’d be interested to hear from anyone who still watches BBC what their tv coverage of the Liverpool gym resistance is. I note that there is no mention of the story on the front pages of their news website, not on the “Home”, “UK” or “Coronavirus” main pages. No mention of it yet on their Live update feed, though there are several mentions of the restrictions in Liverpool and the header for it begins: “Rule breakers blamed for Covid spike”.
Nor did the BBC publish anything about Chris Green resigning as a ministerial aide until some time afterwards and when they did they ‘tucked it away’ in a quiet corner with none of the usual headlines about a government resignation.
On my local news tonight (oz) nothing about gyms, but people went mad in Liverpool bars etc before full lockdown hits.
I’m a bit surprised the penny hasn’t dropped for people that it doesn’t matter if you follow the rules or not. They’ll still apply restrictions until those in power fear their positions.
It was never about anything more than control brought on by idiocy.
Exactly what I’ve been saying and is usually met with a blank stare…..
https://www.dailymail.co.uk/news/article-8838569/Hundreds-65s-normal-died-heart-problems-Covid-crisis-study-shows.html
when I read stuff like this I know we are on the right side of the argument
My family ARE doing Halloween this year. Also Fireworks night and Christmas. We will be having big do’s as we always, er, do.
My problem is what to dress up as, I was gonna go as NHS Death /Grim Reaper but then my brother suggested going as Boris Johnson.
NOW my 101 year old gran has suggested that I go as Matt Hancock!
Decisions decisions.
The only bonus is that if I don’t dress as one of them I can always chuck them on the bonfire a week later.
We have decided to ‘no platform’ Boris and all his friends from our Christmas party. I hope they get salmonella.
London to tier 2 tomorrow night.
Real world expecting Tier 3 today!
Rod Liddell article in the Spectator today.
The cracks are beginning to appear! Lockdown remorse is apparent.
Small victories at skirmish levels, but let’s take them when we get them eh?
Whereas Sherelle Jacobs in the Telegraph seems to have had a crisis of confidence. Apparently we have lost the argument because we are unable to talk the language of the sheeple.
It’s fear. People love to act sceptical when the consequences for being wrong are minimal. So when we were in summer it was easy. Now it’s crunch time. Do you actually believe what you said you did? Where’s the backbone.
Yeah its true – they see increasing numbers and think ‘shit, I was wrong?’ – and it’s RIGHT to question always, but to believe these numbers is to forget one of the crucial pillars of our argument: The +test numbers are false, which means the hospitalisations are false, which means the deaths are false.
Until they fix testing so its actually accurate, then everything else is inaccurate.
I’d like to see what the btl comments were? Can no longer see them on the DT unless you subscribe.
Can we not pool some currency together to buy some land in Tanzania or somewhere as a back up plan. There was something a while back about Putin offering some free hectares in Siberia for those willing to endure it for five years, even that would be better than the Johnson health fascist state we are in now.
All of those who wish to live human lives.
Count me in please
I can cook. Just need Scomo to let me go, oh and I love doing laundry!!!
BBC quote this morning from a doctor talking about Long Covid.
“We are now seeing people who have had no record of having Covid who are suffering more than those that were ventilated for several weeks”
“This is putting a severe burden on the NHS”
This follows a study which interview 14 people on a Long Covid Facebook support group. Many of those surveyed had never even been tested or diagnosed.
This is warped stuff here people.
Yes, make up extreme public health emergency measures on the basis of anecdotal evidence, no context or comparison with incidence and impact of other post-viral conditions
So much different to ordinary ‘Long Pneumonia’ then?
“Pneumonia can be a serious illness that takes weeks or months to recover from.”
https://www.blf.org.uk/support-for-you/pneumonia/recovery
They say it can be categorised 4 ways.
Post viral fatigue
Post intubation syndrome
Permanent organ damage to lungs and heart
Continued CV-19 symptoms
All without context of course.
That sounds like an accurate diagnosis of permanent organ damage less than a year into knowing about Covid-19.
Post viral fatigue is a hypochondriacs wet dream… ‘ohhh im so tired, _something_ must be wrong with me’ fuck off, you pathetic twats.
As for ‘Continued CV-19 symptoms’ – would that be the ‘no symptoms at all’ symptom or the occasional cough or a bit of a headache from time to time. It’s honestly pathetic, there’s nothing unique about these things.
Story of my life, I always thought it was the red wine!
But at least pneumonia has actually been isolated as an actual pathogen, it actually exists!
Whereas Covid-19, by the CDC’s own admission has not been isolated in any setting.
Which pathogen do you have in mind exactly? Pneumonia means congestion of the lungs and can be caused by a number of viruses and/or bacteria?
I expect the dictator sturgeon to trot that shite out at some point today.
Any viral infection can have repercussions for months after, especially flu. Again the government and the media are playing on the absolute ignorance of the UK public. They’ll lap it up in droves.
Facebook is full of groups of people claiming to have all sorts of trendy ailments like Aspergers Syndrome which they have self-diagnosed.
My kids LOVE their new ‘Granny Killa’ ‘T’ shirts. Their grannies and great nanny love them too.
They aren’t so keen on my ‘Fuck Boris’ ‘T’ shirt ‘cos being old they don’t like swearing much.
I wore it on the school run today. It took me 45 minutes longer to get home because lots of people who wouldn’t normally talk to me spoke and agreed! Happy days.
Great post. … and those crony’s becoming stinking rich from all the government contracts awarded without scrutiny
I have never been one for nostalgia. I always regarded it as a defence mechanism for those unwilling to accept inevitable change, and blaming the world for their deficiencies.
What I did not expect was that nostalgia would extend to things like….walking 50 yards from my front door and not seeing someone wearing the Satanic death nappy.
It crushes me every time I see this. I can feel the life being sucked out of me. And I’m not even wearing the bloody thing.
Further to NappyFace’s challenge to the community on 2020-10-12, I’m going to create a website to publish facts (and only facts, no opinions) about this shit show.
The site will be specifically focused on the UK, but will use global references where relevant. Given that I will be the editor, it will of course have a sceptical bias, but I intend to have a high bar for inclusion of “facts” and I will try to present a balanced for-vs-against view for each topic. Overall, my goal is to filter out hysteria and just report what is actually happening.
I was going to name the site coronapedia.org, but that has been taken. Therefore I need an alternative. Here are my suggestions, please comment and / or provide your own suggestions.
I can’t leave the vote open too long in case our opponents squat the domains before I get a chance to register one.
as .uk domains are not very common.
There’s also the .info suffix, which ties in quite well with the stated aim of your website
.org.uk – get it now or it will suddenly be gone
.org.uk sounds “organisey”
How about coronaclaptrap?
For good or for bad, the site is now registered as coronapedia.org.uk.
There’s nothing online right this second, but I’m going to get cracking as soon as possible. Additionally, I’ve taken next week off so I can work on the site full time.
Although I have appointed myself BDFL, I’d like the site to be a community project if possible. Many hands make light work, and all that.
I need to think of a mechanism for the community to pour stuff into the site without me drowning in the deluge.
Just get it up asap. Suffix doesn’t matter, especially to the great unwashed, as they just google for stuff.
It’s done.
Googling didn’t work out so well for the Great Barrington Declaration, though.
Aye. But another reason the suffix doesn’t matter – it’s the name and the content that will be mysteriously banned. Nonetheless, well done.
This week Matt Hancock condemned experts who dared question lockdown. Now, after two of them embarrassingly exposed his basic errors, Prof ANGUS DALGLEISH asks… How IS this petulant, shockingly ignorant minister still in a job?
PROFESSOR ANGUS DALGLEISH: Health Secretary Matt Hancock has had nine long months to educate himself out of his ignorance of the scientific implications of the Covid-19 pandemic. But this week he was still responding to reasoned argument with petulant contempt.
Daily Mail still sticking it to the panickers, even while still publishing Official Truth panic propaganda.
“How IS this petulant, shockingly ignorant minister still in a job?”
Good question.
Honesty, sincerity and competence will instantly disqualify anyone from reaching ‘high’ office…Hancock is perfect for his role…
Look at the fucking tie, I bet he tucks his shirt into his y fronts. A fucking child playing with the grown ups.
No, his nanny does that.
WHAT AN HORRIBLE THOUGHT.
Overcompensation there with the tie.
Has it been fully confirmed the number of cycles being used in the PCR tests? I have seen all sorts of numbers flying around with 45 being the most popular? Surely would be avaialble under a FOI request but I have no idea who to ask??
We asked Essex County Council that. Seeing as they are begging to go into tier 2 we wanted to know the science behind the request. We specifically asked the amplification cycles question; mean, median and mode number please? Response did not even address this question but did include lots of pretty graphs created out of Excel based on a load of assumptions about what the R rate is and could become.
Hancock to announce London moving to tier 2
It is truly pathetic, beyond even my worst nightmares of how stupid and incompetent they could get around this.
Wednesday: Tiers come into play
Thursday: Seems like GM and Lancashire will have tier changed already
Saturday: London tier to change
The WHOLE of London? It’s so utterly ludicrous they can still claim they are ‘local measures’ when you group areas the size of ‘The North West’ and ‘London’ into 1 zone and claim that is appropriate.
We really are fucked for the foreseeable future, nothing is going to stop these idiots, with leaders across Europe all demonstrating a complete inability to face reality and instead opting for societal destruction, and the fucking morons in the rest of the public (aside from a seemingly tiny minority of us) absolutely scared shitless and lapping up the joke of an idea that ‘WE MUST LOCKDOWN!’ as if it’s a tried and tested strategy ffs.
It’s completely fucking ridiculous on any level. Even politically, I cannot believe they’re letting Sadiq Khan have his way b
He’s probably blown all of Londons budget on virtue signalling initatives, accomodating BLM/Antifa/XR
riotsprotests and boarding up Churchill statuesThey’re merely useful idiots, probably going to be paid a lot of money by playing a very masterful game with the big boys of “let’s crash the world’s economy so we can bring in the Great, Global, Green Reset to destroy humanity, and have a this great big playground all for ourselves!” The idiots will be flung aside like the rest of us when their “usefulness” is done.
Oh yes – it’s ridiculous. But not on ‘any level’.
At one level – that of the real motivations – it makes perfect sense, and is proof positive of the underlying political rather than health rationale.
When is today’s update releasing?
Chief covid scaremonger Piers Morgan is getting interviewed by Mike Graham on Talk Radio. God, he really is scum!
Graham needs to up his game
He does, Morgan is getting the upper hand at the moment.
He is the biggest snake in journalism. He threw Trump under the bus, even though he gave Piers the scoop of a lifetime.
Morgan is shouting that 68% of people support lockdown; WE ARE MAKING PROGRESS, I never thought that 32% would be against lockdown( I suppose there’s a tiny minority who “don’t know”,God knows why”)
I think that we can be optimistic for the future.
I think you will find that a lot of people will change their mind next year when they’re finally hit with the bill.
And so they should.
Why isn’t mike hitting him with some with figures?
99.9% survival rate
Only 1.6% of daily deaths are attributed to covid.
PCR test, not fit for purpose.
Lockdowns don’t work, it’s just kicking the can down the road.
God, Morgan is a complete liar.
Sorry, language not excused, way too mild to describe Piers Morgan.
Ask him about his time at the mirror newspaper the phone hacking and the Daniel Morgan case. He is a cunt.
Sorry peeps pissed off today and a bit sweary
Even The Daily Mash is starting to get the hang of it….must have been the Pubs wot did it.
https://www.thedailymash.co.uk/news/health/six-more-appropriate-terms-for-the-current-fk-up-than-circuit-breaker-20201015201461
Re :Piers Morgan: Bulls××t baffles brains.
Hancock: “I was chatting to the virus late the other night in the MP’s bar and it told me that it will suddenly become more deadly in London on Saturday”
The Modus Operandi of the smart virus.
I have escaped to the Greek islands for a break from the madness. It is NORMAL: we can sing and dance in the evening and the locals are telling us to enjoy ourselves and have fun. Some people are wearing masks, as are the hotel staff, but there’s no pressure. I don’t want to return to the Ununited Kingdom and the far from Great Britain.
Well bully for you!
I only wanted to go to Lyme Regis for a week and it doesn’t look like even that will happen.
Which island(s) particularly?
Rhodes
Thanks that’s nice to know. I’m considering a week there in January or possibly on the mainland. I know it’s not that warm but it’s still likely to be better than the UK and it would be so nice just to feel normal again.
Professor Pollard of Oxford Uni says you must all stay locked down, spaced out and masked until next July to give him time to develop his vaccine.
Apparently, on the first test run, all the monkeys contracted coronavirus.
Is that Vicki Pollard? Yeah, but no, but!
Hang on, that’s Boris…isn’t it?
https://www.theguardian.com/world/2020/oct/15/thirty-per-cent-of-newborn-babies-with-covid-contract-it-before-or-during-birth
They wouldn’t have much of a chance to contract it otherwise would they?
Best make my 7 month old self-isolate for 14 days just in case. I’ll just leave a couple of gallons of milk and 42 nappies outside her door and then in two weeks, we know for sure she’s clear.
Well they’ll probably have some immunity to it then won’t they.
The other 70% of newborn babies (e.g. babies that have just been born) probably caught it down the pub or something, that’s why we need to close them.
If it’s infecting 70% of babies, that’s both arms and a leg!!
That’s more than an armful! (Only for older folk that one)
Wondered whether to go with that, but as you say…
‘Can I have me tea and biscuits now?’
As we all know, babies can’t never naturally develop immunity to anything ever – this is why we pump them with about 7 different injections before they can even crawl. (One of the only things the NHS still seems to be able to do)
This is what makes their immunity to things develop. Everyone knows that.
Yeah, they all died before those!
So London to move up a tier on Saturday. No surprises there. Not anything to do with the “wrong sort” of rally being held there on that day, is it Sadiq?
and the extra tier funding
How can they justify it? London is pretty flat in “cases” and has been for months hasn’t it? Is this coming just from Khan or from the government too? If they bump up London surely they need to bump up large swathes of the rest of the country?
Does the new tier ranking specifically prevent demonstrations, though? I can understand that they can shut down speakers on platforms, but I don’t see how they can stop people gathering, say, as individuals, in Trafalgar Square while holding placards, who then all decide, again as individuals, to walk to Downing Street. It’s not different to a group of people walking across Westminster Bridge to work. Unless they ban anybody going out, ever, how can they stop it?
Rod Liddle has had an epiphany in the Spectator (although he thinks that Covid “relishes” attacking a second time therefore herd immunity is impossible):
I argued long and hard back in March and April, insisting that lockdown was a temporary measure and that one way or another things would devolve to normal by… October. That was wrong. I had misjudged the degree to which one small branch of science, unable to see the wood for the trees, was able to grab hold of the levers of power and then decline to relinquish them, wrapped up in its modelling stats — here and in the wider world.
IT WAS F’ING OBVIOUS AT THE TIME YOU IDIOT!
To be fair, I was like that at March and April as there was lots of uncertainty about the virus. People take time to come round to the truth, but it’s better late than never.
True, but those of us who were right from the start are entitled to blow off steam at those like Liddle with opinion influencing pulpits who fell for it back then. Especially as many of them were among those accusing dissenters of being selfish people who only care about money, etc etc.
He was one of the worst, most sanctimonious – yes, I’ll say it – bedwetters.
Judging by the Daily Mail diagram of London, I think South London has gained herd immunity from March/April.
Gyms fundraiser now at £30,000. Next step from Bunter will presumably be £50,000 fines.
As a responsible adult and human being if I am sick I will not risk going out into the community to potentially infect other people.
Just saying. Is that ok!?
Simon Dolan update on Injunction today in Court:
https://twitter.com/simondolan/status/1316693641386176513
https://twitter.com/simondolan/status/1316697421636947968
Video
Dan Carden MP
https://twitter.com/simondolan/status/1316670362717913093
Dan Carden MP – offered his resignation from Labour’s frontbench against the CHIS Bill
https://twitter.com/DanCardenMP/status/1316688726857338880
Worth checking out.
https://www.youtube.com/watch?v=tW2zKerIVtU&feature=youtu.be
Covert Human Intelligence Bill being forced through at warp speed.
https://saveourrights.uk/use-your-voice/covert-human-intelligence
https://saveourrights.uk/use-your-voice/covert-human-intelligence/covert-human-intelligence-letter/
I have just been deleting people from my blog reading list. They all live in the USA.
Person 1 – Her elderly mother recently recovered from pneumonia. She was posting how glad she was it wasn’t Covid as EVERY(her capitals) old person who gets it dies. I sent her a news article about a 106 year old who survived and got a rude reply.
Person 2 – She wrote about a fun day out on a farm her 4 year old son went on. She posted a photo of half a dozen tiny children on the farm. All wearing masks. Child abuse in my view.
Person 3 -(Not removed as she is nice person). She posted about being willing to accompany a relative to scatter their late husband’s ashes as long as they were masked and socially distanced.
I then chatted to a Facebook friend who said she had forgotten what normal feels like. So sad.
On a happier note, I had an email from an 81 year old friend who says we must live with the virus and she is determined to celebrate Christmas with her family as usual. Good for her!